EMAIL THIS PAGE TO A FRIEND

JAM3

junctional adhesion molecule 3

70 Gene Product Result for
Synonyms: JAM-2 JAM-3 JAM-C JAMC
UniProtKB ID: Q9BX67, B3KWG9, Q8WWL8, Q96FL1
Gene ID:
Human(83700) Summary: Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is localized in the tight junctions between high endothelial cells. Unlike other proteins in this family, the this protein is unable to adhere to leukocyte cell lines and only forms weak homotypic interactions. The encoded protein is a member of the junctional adhesion molecule protein family and acts as a receptor for another member of this family. A mutation in an intron of this gene is associated with hemorrhagic destruction of the brain, subependymal calcification, and congenital cataracts. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011]
Mouse(83964) junction adhesion molecule 3
Rat(315509) junctional adhesion molecule 3
chicken(419736) junctional adhesion molecule 3
cow(513412) junctional adhesion molecule 3
domestic cat(101097016) junctional adhesion molecule 3
dog(489271) junctional adhesion molecule 3
sheep(101117375) junctional adhesion molecule 3
domestic guinea pig(100735476) junctional adhesion molecule 3
naked mole-rat(101707307) junctional adhesion molecule 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031470 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031470 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031470 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023277 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023277 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023277 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032801 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032801 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032801 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016271 MISSION® esiRNA esiRNA targeting human JAM3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032801 Rosetta Predictions human pricing
NM_001004269 Rosetta Predictions rat pricing
NM_023277 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147672 predicted 795
2 SASI_Hs01_00147673 predicted 1060
3 SASI_Hs01_00147674 predicted 666
4 SASI_Hs01_00147675 predicted 1070
5 SASI_Hs02_00360362 predicted 490
6 SASI_Hs01_00147676 predicted 965
7 SASI_Hs01_00147678 predicted 871
8 SASI_Hs01_00147679 predicted 1056
9 SASI_Hs01_00147680 predicted 299
10 SASI_Hs01_00147681 predicted 1023
11 SASI_Hs01_00147677 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004269 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077173 predicted 659
2 SASI_Rn01_00077175 predicted 1154
3 SASI_Rn01_00077176 predicted 932
4 SASI_Rn01_00077177 predicted 713
5 SASI_Rn01_00077178 predicted 346
6 SASI_Rn01_00077179 predicted 1079
7 SASI_Rn01_00077180 predicted 819
8 SASI_Rn01_00077181 predicted 405
9 SASI_Rn01_00077182 predicted 1133
10 SASI_Rn02_00198292 predicted 731
11 SASI_Rn01_00077174 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023277 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094162 predicted 516
2 SASI_Mm01_00094163 predicted 849
3 SASI_Mm01_00094164 predicted 877
4 SASI_Mm01_00094165 predicted 214
5 SASI_Mm01_00094166 predicted 782
6 SASI_Mm02_00327015 predicted 912
7 SASI_Mm01_00094167 predicted 316
8 SASI_Mm01_00094168 predicted 761
9 SASI_Mm01_00094169 predicted 714
10 SASI_Mm01_00094170 predicted 964
11 SASI_Mm01_00094171 predicted 842
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031470
VALIDATED
JAM3 MISSION shRNA Bacterial Glycerol Stock
junctional adhesion molecule 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031470.1-717s1c1
Sequence:CCGGCCTGAACATTGGCGGAATTATCTCGAGATAATTCCGCCAATGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031470.1-694s1c1
Sequence:CCGGGAGCAGGAGATGGAAGTCTATCTCGAGATAGACTTCCATCTCCTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031470.1-379s1c1
Sequence:CCGGGATGAGATTGTGATCGAGTTACTCGAGTAACTCGATCACAATCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031470.1-130s1c1
Sequence:CCGGCAGGAATTTGAAAGTGTGGAACTCGAGTTCCACACTTTCAAATTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031470.1-706s1c1
Sequence:CCGGGAAGTCTATGACCTGAACATTCTCGAGAATGTTCAGGTCATAGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031470
VALIDATED
JAM3 MISSION shRNA shRNA Plasmid DNA
junctional adhesion molecule 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031470.1-717s1c1
Sequence:CCGGCCTGAACATTGGCGGAATTATCTCGAGATAATTCCGCCAATGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031470.1-694s1c1
Sequence:CCGGGAGCAGGAGATGGAAGTCTATCTCGAGATAGACTTCCATCTCCTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031470.1-379s1c1
Sequence:CCGGGATGAGATTGTGATCGAGTTACTCGAGTAACTCGATCACAATCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031470.1-130s1c1
Sequence:CCGGCAGGAATTTGAAAGTGTGGAACTCGAGTTCCACACTTTCAAATTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031470.1-706s1c1
Sequence:CCGGGAAGTCTATGACCTGAACATTCTCGAGAATGTTCAGGTCATAGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031470
VALIDATED
JAM3 MISSION shRNA Lentiviral Transduction Particles
junctional adhesion molecule 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031470.1-717s1c1
Sequence:CCGGCCTGAACATTGGCGGAATTATCTCGAGATAATTCCGCCAATGTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031470.1-694s1c1
Sequence:CCGGGAGCAGGAGATGGAAGTCTATCTCGAGATAGACTTCCATCTCCTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031470.1-379s1c1
Sequence:CCGGGATGAGATTGTGATCGAGTTACTCGAGTAACTCGATCACAATCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031470.1-130s1c1
Sequence:CCGGCAGGAATTTGAAAGTGTGGAACTCGAGTTCCACACTTTCAAATTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031470.1-706s1c1
Sequence:CCGGGAAGTCTATGACCTGAACATTCTCGAGAATGTTCAGGTCATAGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023277
VALIDATED
JAM3 MISSION shRNA Bacterial Glycerol Stock
junctional adhesion molecule 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023277.1-233s1c1
Sequence:CCGGGCCAAACCACATATGTGTATTCTCGAGAATACACATATGTGGTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023277.1-394s1c1
Sequence:CCGGGATGAGATTACCATTGAGTTACTCGAGTAACTCAATGGTAATCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023277.1-772s1c1
Sequence:CCGGCTTATTGTTCTTGCTGTGATTCTCGAGAATCACAGCAAGAACAATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023277.1-1471s1c1
Sequence:CCGGCCCAAATCAGAAAGGTGAAATCTCGAGATTTCACCTTTCTGATTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023277.1-366s1c1
Sequence:CCGGCGTTGCTCTAAATGACCGAAACTCGAGTTTCGGTCATTTAGAGCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023277.1-712s1c1
Sequence:CCGGCAGGACATGGAAGTCTATGATCTCGAGATCATAGACTTCCATGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023277.3-1470s21c1
Sequence:CCGGCCCAAATCAGAAAGGTGAAATCTCGAGATTTCACCTTTCTGATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023277.3-393s21c1
Sequence:CCGGGATGAGATTACCATTGAGTTACTCGAGTAACTCAATGGTAATCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023277.3-1407s1c1
Sequence:CCGGGATTGGCCAGTACTGTCATTTCTCGAGAAATGACAGTACTGGCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023277.3-771s21c1
Sequence:CCGGCTTATTGTTCTTGCTGTGATTCTCGAGAATCACAGCAAGAACAATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023277.3-160s21c1
Sequence:CCGGTGGAATTGTCTTGCATCATTACTCGAGTAATGATGCAAGACAATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023277
VALIDATED
JAM3 MISSION shRNA shRNA Plasmid DNA
junctional adhesion molecule 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023277.1-233s1c1
Sequence:CCGGGCCAAACCACATATGTGTATTCTCGAGAATACACATATGTGGTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023277.1-394s1c1
Sequence:CCGGGATGAGATTACCATTGAGTTACTCGAGTAACTCAATGGTAATCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023277.1-772s1c1
Sequence:CCGGCTTATTGTTCTTGCTGTGATTCTCGAGAATCACAGCAAGAACAATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023277.1-1471s1c1
Sequence:CCGGCCCAAATCAGAAAGGTGAAATCTCGAGATTTCACCTTTCTGATTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023277.1-366s1c1
Sequence:CCGGCGTTGCTCTAAATGACCGAAACTCGAGTTTCGGTCATTTAGAGCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023277.1-712s1c1
Sequence:CCGGCAGGACATGGAAGTCTATGATCTCGAGATCATAGACTTCCATGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023277.3-1470s21c1
Sequence:CCGGCCCAAATCAGAAAGGTGAAATCTCGAGATTTCACCTTTCTGATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023277.3-393s21c1
Sequence:CCGGGATGAGATTACCATTGAGTTACTCGAGTAACTCAATGGTAATCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023277.3-1407s1c1
Sequence:CCGGGATTGGCCAGTACTGTCATTTCTCGAGAAATGACAGTACTGGCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023277.3-771s21c1
Sequence:CCGGCTTATTGTTCTTGCTGTGATTCTCGAGAATCACAGCAAGAACAATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023277.3-160s21c1
Sequence:CCGGTGGAATTGTCTTGCATCATTACTCGAGTAATGATGCAAGACAATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023277
VALIDATED
JAM3 MISSION shRNA Lentiviral Transduction Particles
junctional adhesion molecule 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023277.1-233s1c1
Sequence:CCGGGCCAAACCACATATGTGTATTCTCGAGAATACACATATGTGGTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023277.1-394s1c1
Sequence:CCGGGATGAGATTACCATTGAGTTACTCGAGTAACTCAATGGTAATCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023277.1-772s1c1
Sequence:CCGGCTTATTGTTCTTGCTGTGATTCTCGAGAATCACAGCAAGAACAATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023277.1-1471s1c1
Sequence:CCGGCCCAAATCAGAAAGGTGAAATCTCGAGATTTCACCTTTCTGATTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023277.1-366s1c1
Sequence:CCGGCGTTGCTCTAAATGACCGAAACTCGAGTTTCGGTCATTTAGAGCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023277.1-712s1c1
Sequence:CCGGCAGGACATGGAAGTCTATGATCTCGAGATCATAGACTTCCATGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023277.3-1470s21c1
Sequence:CCGGCCCAAATCAGAAAGGTGAAATCTCGAGATTTCACCTTTCTGATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023277.3-393s21c1
Sequence:CCGGGATGAGATTACCATTGAGTTACTCGAGTAACTCAATGGTAATCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023277.3-1407s1c1
Sequence:CCGGGATTGGCCAGTACTGTCATTTCTCGAGAAATGACAGTACTGGCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023277.3-771s21c1
Sequence:CCGGCTTATTGTTCTTGCTGTGATTCTCGAGAATCACAGCAAGAACAATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023277.3-160s21c1
Sequence:CCGGTGGAATTGTCTTGCATCATTACTCGAGTAATGATGCAAGACAATTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032801
VALIDATED
JAM3 MISSION shRNA Bacterial Glycerol Stock
junctional adhesion molecule 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032801.3-716s21c1
Sequence:CCGGCCAATCCCAGATTTCGCAATTCTCGAGAATTGCGAAATCTGGGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032801.3-305s21c1
Sequence:CCGGTGGAACTGTCTTGCATCATTACTCGAGTAATGATGCAAGACAGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032801.3-853s21c1
Sequence:CCGGGAGCAGGAGATGGAAGTCTATCTCGAGATAGACTTCCATCTCCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032801.3-1130s21c1
Sequence:CCGGGCACATACCTCTGCTAGAAACCTCGAGGTTTCTAGCAGAGGTATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032801.3-539s21c1
Sequence:CCGGATGAGATTGTGATCGAGTTAACTCGAGTTAACTCGATCACAATCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032801
VALIDATED
JAM3 MISSION shRNA shRNA Plasmid DNA
junctional adhesion molecule 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032801.3-716s21c1
Sequence:CCGGCCAATCCCAGATTTCGCAATTCTCGAGAATTGCGAAATCTGGGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032801.3-305s21c1
Sequence:CCGGTGGAACTGTCTTGCATCATTACTCGAGTAATGATGCAAGACAGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032801.3-853s21c1
Sequence:CCGGGAGCAGGAGATGGAAGTCTATCTCGAGATAGACTTCCATCTCCTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032801.3-1130s21c1
Sequence:CCGGGCACATACCTCTGCTAGAAACCTCGAGGTTTCTAGCAGAGGTATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032801.3-539s21c1
Sequence:CCGGATGAGATTGTGATCGAGTTAACTCGAGTTAACTCGATCACAATCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032801
VALIDATED
JAM3 MISSION shRNA Lentiviral Transduction Particles
junctional adhesion molecule 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032801.3-716s21c1
Sequence:CCGGCCAATCCCAGATTTCGCAATTCTCGAGAATTGCGAAATCTGGGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032801.3-305s21c1
Sequence:CCGGTGGAACTGTCTTGCATCATTACTCGAGTAATGATGCAAGACAGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032801.3-853s21c1
Sequence:CCGGGAGCAGGAGATGGAAGTCTATCTCGAGATAGACTTCCATCTCCTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032801.3-1130s21c1
Sequence:CCGGGCACATACCTCTGCTAGAAACCTCGAGGTTTCTAGCAGAGGTATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032801.3-539s21c1
Sequence:CCGGATGAGATTGTGATCGAGTTAACTCGAGTTAACTCGATCACAATCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)