EMAIL THIS PAGE TO A FRIEND

JARID2

jumonji, AT rich interactive domain 2

225 Gene Product Result for
Synonyms: JMJ
UniProtKB ID: Q92833, A8K9Z6, B7Z5S5, B7Z8L0, Q5U5L5, Q86X63
Gene ID:
Human(3720) Summary: This gene encodes a Jumonji- and AT-rich interaction domain (ARID)-domain-containing protein. The encoded protein is a DNA-binding protein that functions as a transcriptional repressor. This protein interacts with the Polycomb repressive complex 2 (PRC2) which plays an essential role in regulating gene expression during embryonic development. This protein facilitates the recruitment of the PRC2 complex to target genes. Alternate splicing results in multiple transcript variants. Mutations in this gene are associated with chronic myeloid malignancies. [provided by RefSeq, May 2012]
Mouse(16468) jumonji, AT rich interactive domain 2
Rat(681740) jumonji, AT rich interactive domain 2
fruit fly(39103) Jumonji, AT rich interactive domain 2
chicken(420839) jumonji, AT rich interactive domain 2
domestic cat(101093520) jumonji, AT rich interactive domain 2
cow(528253) jumonji, AT rich interactive domain 2
Horse(100051819) jumonji, AT rich interactive domain 2
dog(478729) jumonji, AT rich interactive domain 2
sheep(101113542) jumonji, AT rich interactive domain 2
domestic guinea pig(100728421) jumonji, AT rich interactive domain 2
naked mole-rat(101714621) jumonji, AT rich interactive domain 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004973 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004973 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004973 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004973 Rosetta Predictions human pricing
XM_001056690 Rosetta Predictions rat pricing
XM_001056762 Rosetta Predictions rat pricing
XM_001056826 Rosetta Predictions rat pricing
XM_001056897 Rosetta Predictions rat pricing
XM_001056960 Rosetta Predictions rat pricing
NM_021878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179905 predicted 668
2 SASI_Hs01_00179906 predicted 582
3 SASI_Hs01_00179907 predicted 3390
4 SASI_Hs01_00179908 predicted 443
5 SASI_Hs01_00179909 predicted 604
6 SASI_Hs01_00179910 predicted 3419
7 SASI_Hs01_00179911 predicted 2501
8 SASI_Hs01_00179912 predicted 3277
9 SASI_Hs02_00338677 predicted 3418
10 SASI_Hs01_00179913 predicted 1140
11 SASI_Hs01_00179914 predicted 1401
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284082 predicted 3686
2 SASI_Rn02_00284083 predicted 954
3 SASI_Rn02_00284084 predicted 3111
4 SASI_Rn02_00284085 predicted 3638
5 SASI_Rn02_00284086 predicted 2889
6 SASI_Rn02_00284087 predicted 3087
7 SASI_Rn02_00284088 predicted 2319
8 SASI_Rn02_00284089 predicted 2500
9 SASI_Rn02_00284090 predicted 1217
10 SASI_Rn02_00284091 predicted 3665
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284346 predicted 452
2 SASI_Rn02_00284347 predicted 1264
3 SASI_Rn02_00284348 predicted 575
4 SASI_Rn02_00284349 predicted 3946
5 SASI_Rn02_00284350 predicted 3401
6 SASI_Rn02_00284351 predicted 2629
7 SASI_Rn02_00284352 predicted 537
8 SASI_Rn02_00284353 predicted 2805
9 SASI_Rn02_00284354 predicted 1523
10 SASI_Rn02_00284355 predicted 3978
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056826 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284570 predicted 360
2 SASI_Rn02_00284571 predicted 1169
3 SASI_Rn02_00284572 predicted 477
4 SASI_Rn02_00284573 predicted 3841
5 SASI_Rn02_00284574 predicted 3295
6 SASI_Rn02_00284575 predicted 2529
7 SASI_Rn02_00284576 predicted 442
8 SASI_Rn02_00284577 predicted 2712
9 SASI_Rn02_00284578 predicted 1430
10 SASI_Rn02_00284579 predicted 3880
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284800 predicted 360
2 SASI_Rn02_00284801 predicted 1167
3 SASI_Rn02_00284802 predicted 473
4 SASI_Rn02_00284803 predicted 3842
5 SASI_Rn02_00284804 predicted 3297
6 SASI_Rn02_00284805 predicted 2527
7 SASI_Rn02_00284806 predicted 439
8 SASI_Rn02_00284807 predicted 2707
9 SASI_Rn02_00284808 predicted 1430
10 SASI_Rn02_00284809 predicted 3879
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284950 predicted 672
2 SASI_Rn02_00284951 predicted 1485
3 SASI_Rn02_00284952 predicted 789
4 SASI_Rn02_00284953 predicted 4159
5 SASI_Rn02_00284954 predicted 3615
6 SASI_Rn02_00284955 predicted 2845
7 SASI_Rn02_00284956 predicted 752
8 SASI_Rn02_00284957 predicted 3023
9 SASI_Rn02_00284958 predicted 1741
10 SASI_Rn02_00284959 predicted 4190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326437 predicted 3214
2 SASI_Mm01_00093112 predicted 1085
3 SASI_Mm01_00093113 predicted 361
4 SASI_Mm01_00093114 predicted 3767
5 SASI_Mm01_00093115 predicted 1345
6 SASI_Mm01_00093116 predicted 3013
7 SASI_Mm01_00093117 predicted 2706
8 SASI_Mm01_00093118 predicted 2633
9 SASI_Mm01_00093119 predicted 227
10 SASI_Mm01_00093120 predicted 2986
11 SASI_Mm01_00093111 predicted 3813
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021878
VALIDATED
JARID2 MISSION shRNA Bacterial Glycerol Stock
jumonji, AT rich interactive domain 2
Mouse
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-2013s21c1
Sequence:CCGGCAGATCCAGCACATCCATAAGCTCGAGCTTATGGATGTGCTGGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-605s21c1
Sequence:CCGGCCCGCCAGCTACTCAAATTTCCTCGAGGAAATTTGAGTAGCTGGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-3361s21c1
Sequence:CCGGAGAAGTTGCTCTACCAGATTGCTCGAGCAATCTGGTAGAGCAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021878.2-3901s21c1
Sequence:CCGGGCCGAACCCATGGTCACTTATCTCGAGATAAGTGACCATGGGTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-458s21c1
Sequence:CCGGCTCTACTAGCAACGATGTTAGCTCGAGCTAACATCGTTGCTAGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021878.2-3977s21c1
Sequence:CCGGTGTCTTTGCACTAGCTCTAAACTCGAGTTTAGAGCTAGTGCAAAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-2920s21c1
Sequence:CCGGTGACTATTCCCTGGCTAAATACTCGAGTATTTAGCCAGGGAATAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-2778s21c1
Sequence:CCGGTGCGGAAAGGTGGACACTAATCTCGAGATTAGTGTCCACCTTTCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-2611s21c1
Sequence:CCGGACTTCCACAAGTGCATCTATACTCGAGTATAGATGCACTTGTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021878.2-697s21c1
Sequence:CCGGTGCCCAACAGTATGGTATATTCTCGAGAATATACCATACTGTTGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021878.2-4207s21c1
Sequence:CCGGTGGTAACTGTTGAGGAATAAACTCGAGTTTATTCCTCAACAGTTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-2989s21c1
Sequence:CCGGTTCCATATATTGACTACTTACCTCGAGGTAAGTAGTCAATATATGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-541s21c1
Sequence:CCGGTTGCTCAATCTCAGCCGAATACTCGAGTATTCGGCTGAGATTGAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021878.2-4748s1c1
Sequence:CCGGCCTGTCATCCATGTGCAATTTCTCGAGAAATTGCACATGGATGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021878.2-784s1c1
Sequence:CCGGCCACCAACAATGCTTCATCTTCTCGAGAAGATGAAGCATTGTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021878.2-695s1c1
Sequence:CCGGGCTGCCCAACAGTATGGTATACTCGAGTATACCATACTGTTGGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021878.2-1430s1c1
Sequence:CCGGGAACCCAAAGTCATGCACTAACTCGAGTTAGTGCATGACTTTGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021878.2-3332s1c1
Sequence:CCGGCCGCCATATAGCTAAGCCATTCTCGAGAATGGCTTAGCTATATGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021878
VALIDATED
JARID2 MISSION shRNA shRNA Plasmid DNA
jumonji, AT rich interactive domain 2
Mouse
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-2013s21c1
Sequence:CCGGCAGATCCAGCACATCCATAAGCTCGAGCTTATGGATGTGCTGGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-605s21c1
Sequence:CCGGCCCGCCAGCTACTCAAATTTCCTCGAGGAAATTTGAGTAGCTGGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-3361s21c1
Sequence:CCGGAGAAGTTGCTCTACCAGATTGCTCGAGCAATCTGGTAGAGCAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021878.2-3901s21c1
Sequence:CCGGGCCGAACCCATGGTCACTTATCTCGAGATAAGTGACCATGGGTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-458s21c1
Sequence:CCGGCTCTACTAGCAACGATGTTAGCTCGAGCTAACATCGTTGCTAGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021878.2-3977s21c1
Sequence:CCGGTGTCTTTGCACTAGCTCTAAACTCGAGTTTAGAGCTAGTGCAAAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-2920s21c1
Sequence:CCGGTGACTATTCCCTGGCTAAATACTCGAGTATTTAGCCAGGGAATAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-2778s21c1
Sequence:CCGGTGCGGAAAGGTGGACACTAATCTCGAGATTAGTGTCCACCTTTCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-2611s21c1
Sequence:CCGGACTTCCACAAGTGCATCTATACTCGAGTATAGATGCACTTGTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021878.2-697s21c1
Sequence:CCGGTGCCCAACAGTATGGTATATTCTCGAGAATATACCATACTGTTGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021878.2-4207s21c1
Sequence:CCGGTGGTAACTGTTGAGGAATAAACTCGAGTTTATTCCTCAACAGTTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-2989s21c1
Sequence:CCGGTTCCATATATTGACTACTTACCTCGAGGTAAGTAGTCAATATATGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-541s21c1
Sequence:CCGGTTGCTCAATCTCAGCCGAATACTCGAGTATTCGGCTGAGATTGAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021878.2-4748s1c1
Sequence:CCGGCCTGTCATCCATGTGCAATTTCTCGAGAAATTGCACATGGATGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021878.2-784s1c1
Sequence:CCGGCCACCAACAATGCTTCATCTTCTCGAGAAGATGAAGCATTGTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021878.2-695s1c1
Sequence:CCGGGCTGCCCAACAGTATGGTATACTCGAGTATACCATACTGTTGGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021878.2-1430s1c1
Sequence:CCGGGAACCCAAAGTCATGCACTAACTCGAGTTAGTGCATGACTTTGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021878.2-3332s1c1
Sequence:CCGGCCGCCATATAGCTAAGCCATTCTCGAGAATGGCTTAGCTATATGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021878
VALIDATED
JARID2 MISSION shRNA Lentiviral Transduction Particles
jumonji, AT rich interactive domain 2
Mouse
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-2013s21c1
Sequence:CCGGCAGATCCAGCACATCCATAAGCTCGAGCTTATGGATGTGCTGGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-605s21c1
Sequence:CCGGCCCGCCAGCTACTCAAATTTCCTCGAGGAAATTTGAGTAGCTGGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-3361s21c1
Sequence:CCGGAGAAGTTGCTCTACCAGATTGCTCGAGCAATCTGGTAGAGCAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021878.2-3901s21c1
Sequence:CCGGGCCGAACCCATGGTCACTTATCTCGAGATAAGTGACCATGGGTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-458s21c1
Sequence:CCGGCTCTACTAGCAACGATGTTAGCTCGAGCTAACATCGTTGCTAGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021878.2-3977s21c1
Sequence:CCGGTGTCTTTGCACTAGCTCTAAACTCGAGTTTAGAGCTAGTGCAAAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-2920s21c1
Sequence:CCGGTGACTATTCCCTGGCTAAATACTCGAGTATTTAGCCAGGGAATAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-2778s21c1
Sequence:CCGGTGCGGAAAGGTGGACACTAATCTCGAGATTAGTGTCCACCTTTCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-2611s21c1
Sequence:CCGGACTTCCACAAGTGCATCTATACTCGAGTATAGATGCACTTGTGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021878.2-697s21c1
Sequence:CCGGTGCCCAACAGTATGGTATATTCTCGAGAATATACCATACTGTTGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021878.2-4207s21c1
Sequence:CCGGTGGTAACTGTTGAGGAATAAACTCGAGTTTATTCCTCAACAGTTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-2989s21c1
Sequence:CCGGTTCCATATATTGACTACTTACCTCGAGGTAAGTAGTCAATATATGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021878.2-541s21c1
Sequence:CCGGTTGCTCAATCTCAGCCGAATACTCGAGTATTCGGCTGAGATTGAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021878.2-4748s1c1
Sequence:CCGGCCTGTCATCCATGTGCAATTTCTCGAGAAATTGCACATGGATGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021878.2-784s1c1
Sequence:CCGGCCACCAACAATGCTTCATCTTCTCGAGAAGATGAAGCATTGTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021878.2-695s1c1
Sequence:CCGGGCTGCCCAACAGTATGGTATACTCGAGTATACCATACTGTTGGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021878.2-1430s1c1
Sequence:CCGGGAACCCAAAGTCATGCACTAACTCGAGTTAGTGCATGACTTTGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021878.2-3332s1c1
Sequence:CCGGCCGCCATATAGCTAAGCCATTCTCGAGAATGGCTTAGCTATATGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004973
VALIDATED
JARID2 MISSION shRNA Bacterial Glycerol Stock
jumonji, AT rich interactive domain 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004973.2-1144s21c1
Sequence:CCGGGAAACAGGTTTCTAAGGTAAACTCGAGTTTACCTTAGAAACCTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004973.2-751s21c1
Sequence:CCGGGCCCAACAGCATGGTGTATTTCTCGAGAAATACACCATGCTGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004973.2-2719s21c1
Sequence:CCGGTTATCGAACAGCGAGGAATATCTCGAGATATTCCTCGCTGTTCGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004973.2-3992s21c1
Sequence:CCGGCAACGCCCGTGGTCGATTTATCTCGAGATAAATCGACCACGGGCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004973.2-2979s21c1
Sequence:CCGGTGACTATTCCCTGGCTAAATACTCGAGTATTTAGCCAGGGAATAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004973.2-2670s21c1
Sequence:CCGGACTTCCACAAGTGCATCTATACTCGAGTATAGATGCACTTGTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004973.2-5259s1c1
Sequence:CCGGGCTGCTTACATCACTGAACAACTCGAGTTGTTCAGTGATGTAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004973.2-513s1c1
Sequence:CCGGCCACTAGCAACGATGTTAGTTCTCGAGAACTAACATCGTTGCTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004973.2-1144s1c1
Sequence:CCGGGAAACAGGTTTCTAAGGTAAACTCGAGTTTACCTTAGAAACCTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004973.2-510s1c1
Sequence:CCGGCCTCCACTAGCAACGATGTTACTCGAGTAACATCGTTGCTAGTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004973.2-3791s1c1
Sequence:CCGGCGCTACGATGAGGAACAGATTCTCGAGAATCTGTTCCTCATCGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004973
VALIDATED
JARID2 MISSION shRNA shRNA Plasmid DNA
jumonji, AT rich interactive domain 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004973.2-1144s21c1
Sequence:CCGGGAAACAGGTTTCTAAGGTAAACTCGAGTTTACCTTAGAAACCTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004973.2-751s21c1
Sequence:CCGGGCCCAACAGCATGGTGTATTTCTCGAGAAATACACCATGCTGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004973.2-2719s21c1
Sequence:CCGGTTATCGAACAGCGAGGAATATCTCGAGATATTCCTCGCTGTTCGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004973.2-3992s21c1
Sequence:CCGGCAACGCCCGTGGTCGATTTATCTCGAGATAAATCGACCACGGGCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004973.2-2979s21c1
Sequence:CCGGTGACTATTCCCTGGCTAAATACTCGAGTATTTAGCCAGGGAATAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004973.2-2670s21c1
Sequence:CCGGACTTCCACAAGTGCATCTATACTCGAGTATAGATGCACTTGTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004973.2-5259s1c1
Sequence:CCGGGCTGCTTACATCACTGAACAACTCGAGTTGTTCAGTGATGTAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004973.2-513s1c1
Sequence:CCGGCCACTAGCAACGATGTTAGTTCTCGAGAACTAACATCGTTGCTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004973.2-1144s1c1
Sequence:CCGGGAAACAGGTTTCTAAGGTAAACTCGAGTTTACCTTAGAAACCTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004973.2-510s1c1
Sequence:CCGGCCTCCACTAGCAACGATGTTACTCGAGTAACATCGTTGCTAGTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004973.2-3791s1c1
Sequence:CCGGCGCTACGATGAGGAACAGATTCTCGAGAATCTGTTCCTCATCGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004973
VALIDATED
JARID2 MISSION shRNA Lentiviral Transduction Particles
jumonji, AT rich interactive domain 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004973.2-1144s21c1
Sequence:CCGGGAAACAGGTTTCTAAGGTAAACTCGAGTTTACCTTAGAAACCTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004973.2-751s21c1
Sequence:CCGGGCCCAACAGCATGGTGTATTTCTCGAGAAATACACCATGCTGTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004973.2-2719s21c1
Sequence:CCGGTTATCGAACAGCGAGGAATATCTCGAGATATTCCTCGCTGTTCGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004973.2-3992s21c1
Sequence:CCGGCAACGCCCGTGGTCGATTTATCTCGAGATAAATCGACCACGGGCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004973.2-2979s21c1
Sequence:CCGGTGACTATTCCCTGGCTAAATACTCGAGTATTTAGCCAGGGAATAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004973.2-2670s21c1
Sequence:CCGGACTTCCACAAGTGCATCTATACTCGAGTATAGATGCACTTGTGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004973.2-5259s1c1
Sequence:CCGGGCTGCTTACATCACTGAACAACTCGAGTTGTTCAGTGATGTAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004973.2-513s1c1
Sequence:CCGGCCACTAGCAACGATGTTAGTTCTCGAGAACTAACATCGTTGCTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004973.2-1144s1c1
Sequence:CCGGGAAACAGGTTTCTAAGGTAAACTCGAGTTTACCTTAGAAACCTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004973.2-510s1c1
Sequence:CCGGCCTCCACTAGCAACGATGTTACTCGAGTAACATCGTTGCTAGTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004973.2-3791s1c1
Sequence:CCGGCGCTACGATGAGGAACAGATTCTCGAGAATCTGTTCCTCATCGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)