EMAIL THIS PAGE TO A FRIEND

JAZF1

JAZF zinc finger 1

208 Gene Product Result for
Synonyms: TIP27 ZNF802
UniProtKB ID: Q86VZ6, A4D195, Q8N3L7
Gene ID:
Human(221895) Summary: This gene encodes a nuclear protein with three C2H2-type zinc fingers, and functions as a transcriptional repressor. Chromosomal aberrations involving this gene are associated with endometrial stromal tumors. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized [provided by RefSeq, Jul 2008]
Mouse(231986) JAZF zinc finger 1
Rat(685879) JAZF zinc finger 1
chicken(420633) JAZF zinc finger 1
cow(616701) JAZF zinc finger 1
dog(475265) JAZF zinc finger 1
sheep(101113233) JAZF zinc finger 1
domestic guinea pig(100718483) JAZF zinc finger 1
naked mole-rat(101703896) JAZF zinc finger 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175061 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175061 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175061 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062051 MISSION® esiRNA esiRNA human JAZF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175061 Rosetta Predictions human pricing
XM_001065610 Rosetta Predictions rat pricing
NM_173406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368959 predicted 426
2 SASI_Hs01_00081839 predicted 792
3 SASI_Hs02_00368960 predicted 453
4 SASI_Hs01_00081840 predicted 813
5 SASI_Hs01_00081842 predicted 693
6 SASI_Hs01_00081843 predicted 972
7 SASI_Hs01_00081844 predicted 836
8 SASI_Hs01_00081845 predicted 987
9 SASI_Hs01_00081846 predicted 954
10 SASI_Hs01_00081847 predicted 955
11 SASI_Hs01_00081841 predicted 1054
12 SASI_Hs01_00081848 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314844 predicted 514
2 SASI_Rn02_00314845 predicted 463
3 SASI_Rn02_00314846 predicted 417
4 SASI_Rn02_00314847 predicted 525
5 SASI_Rn02_00314848 predicted 509
6 SASI_Rn02_00314849 predicted 504
7 SASI_Rn02_00314850 predicted 514
8 SASI_Rn02_00314851 predicted 539
9 SASI_Rn02_00314852 predicted 481
10 SASI_Rn02_00314853 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026727 predicted 1045
2 SASI_Mm01_00026728 predicted 589
3 SASI_Mm01_00026729 predicted 215
4 SASI_Mm01_00026730 predicted 893
5 SASI_Mm02_00345263 predicted 1049
6 SASI_Mm01_00026732 predicted 624
7 SASI_Mm02_00345264 predicted 905
8 SASI_Mm01_00026734 predicted 433
9 SASI_Mm01_00026735 predicted 261
10 SASI_Mm02_00345265 predicted 931
11 SASI_Mm01_00026731 predicted 337
12 SASI_Mm01_00026733 predicted 200
13 SASI_Mm01_00026736 predicted 907
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173406
JAZF1 MISSION shRNA Bacterial Glycerol Stock
JAZF zinc finger 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173406.1-1367s1c1
Sequence:CCGGGCCCTTTAAGAAGCTGAAATTCTCGAGAATTTCAGCTTCTTAAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173406.1-636s1c1
Sequence:CCGGCGCGTCCGCAAACCATTCAAACTCGAGTTTGAATGGTTTGCGGACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173406.1-584s1c1
Sequence:CCGGGAATGTGAATGGCATAAAGTACTCGAGTACTTTATGCCATTCACATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173406.1-699s1c1
Sequence:CCGGCACCACACAATCAATTTCCATCTCGAGATGGAAATTGATTGTGTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173406.1-200s1c1
Sequence:CCGGCCTCAGTTACATCAATAGATTCTCGAGAATCTATTGATGTAACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173406
JAZF1 MISSION shRNA shRNA Plasmid DNA
JAZF zinc finger 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173406.1-1367s1c1
Sequence:CCGGGCCCTTTAAGAAGCTGAAATTCTCGAGAATTTCAGCTTCTTAAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173406.1-636s1c1
Sequence:CCGGCGCGTCCGCAAACCATTCAAACTCGAGTTTGAATGGTTTGCGGACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173406.1-584s1c1
Sequence:CCGGGAATGTGAATGGCATAAAGTACTCGAGTACTTTATGCCATTCACATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173406.1-699s1c1
Sequence:CCGGCACCACACAATCAATTTCCATCTCGAGATGGAAATTGATTGTGTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173406.1-200s1c1
Sequence:CCGGCCTCAGTTACATCAATAGATTCTCGAGAATCTATTGATGTAACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173406
JAZF1 MISSION shRNA Lentiviral Transduction Particles
JAZF zinc finger 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173406.1-1367s1c1
Sequence:CCGGGCCCTTTAAGAAGCTGAAATTCTCGAGAATTTCAGCTTCTTAAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173406.1-636s1c1
Sequence:CCGGCGCGTCCGCAAACCATTCAAACTCGAGTTTGAATGGTTTGCGGACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173406.1-584s1c1
Sequence:CCGGGAATGTGAATGGCATAAAGTACTCGAGTACTTTATGCCATTCACATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173406.1-699s1c1
Sequence:CCGGCACCACACAATCAATTTCCATCTCGAGATGGAAATTGATTGTGTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173406.1-200s1c1
Sequence:CCGGCCTCAGTTACATCAATAGATTCTCGAGAATCTATTGATGTAACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175061
VALIDATED
JAZF1 MISSION shRNA Bacterial Glycerol Stock
JAZF zinc finger 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175061.2-2592s1c1
Sequence:CCGGCGCTCTTTCTAGTGCAAGAAACTCGAGTTTCTTGCACTAGAAAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175061.2-187s1c1
Sequence:CCGGCAACCTATGTTGCCCTGAGTTCTCGAGAACTCAGGGCAACATAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175061.2-195s1c1
Sequence:CCGGGTTGCCCTGAGTTACATAAATCTCGAGATTTATGTAACTCAGGGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175061.2-698s1c1
Sequence:CCGGGCACCACACAATCAATTTCCACTCGAGTGGAAATTGATTGTGTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175061.2-695s1c1
Sequence:CCGGGCGGCACCACACAATCAATTTCTCGAGAAATTGATTGTGTGGTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-269s21c1
Sequence:CCGGTTCTCCAATACCTGCCGATTCCTCGAGGAATCGGCAGGTATTGGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-937s21c1
Sequence:CCGGGGTGTCGGCTGAGATTATCAGCTCGAGCTGATAATCTCAGCCGACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-828s21c1
Sequence:CCGGATGGTCACAGAACACAGATTCCTCGAGGAATCTGTGTTCTGTGACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-793s21c1
Sequence:CCGGCAAGAATGTGAATGGCATAAACTCGAGTTTATGCCATTCACATTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-2341s21c1
Sequence:CCGGGAGTTTACCAGTTGCCTAATACTCGAGTATTAGGCAACTGGTAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175061.3-968s21c1
Sequence:CCGGCAATAACATGCTGGTCATAACCTCGAGGTTATGACCAGCATGTTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-720s21c1
Sequence:CCGGTCAGCTCCATGTGCATGAATGCTCGAGCATTCATGCACATGGAGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-1758s21c1
Sequence:CCGGGCGGACCAAGATACCCATTTACTCGAGTAAATGGGTATCTTGGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175061.3-354s21c1
Sequence:CCGGTCGATACAGATCCACGGGTTTCTCGAGAAACCCGTGGATCTGTATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175061.3-764s21c1
Sequence:CCGGTGCCCAGTTCCTGGATGTAAACTCGAGTTTACATCCAGGAACTGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175061
VALIDATED
JAZF1 MISSION shRNA shRNA Plasmid DNA
JAZF zinc finger 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175061.2-2592s1c1
Sequence:CCGGCGCTCTTTCTAGTGCAAGAAACTCGAGTTTCTTGCACTAGAAAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175061.2-187s1c1
Sequence:CCGGCAACCTATGTTGCCCTGAGTTCTCGAGAACTCAGGGCAACATAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175061.2-195s1c1
Sequence:CCGGGTTGCCCTGAGTTACATAAATCTCGAGATTTATGTAACTCAGGGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175061.2-698s1c1
Sequence:CCGGGCACCACACAATCAATTTCCACTCGAGTGGAAATTGATTGTGTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175061.2-695s1c1
Sequence:CCGGGCGGCACCACACAATCAATTTCTCGAGAAATTGATTGTGTGGTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-269s21c1
Sequence:CCGGTTCTCCAATACCTGCCGATTCCTCGAGGAATCGGCAGGTATTGGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-937s21c1
Sequence:CCGGGGTGTCGGCTGAGATTATCAGCTCGAGCTGATAATCTCAGCCGACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-828s21c1
Sequence:CCGGATGGTCACAGAACACAGATTCCTCGAGGAATCTGTGTTCTGTGACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-793s21c1
Sequence:CCGGCAAGAATGTGAATGGCATAAACTCGAGTTTATGCCATTCACATTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-2341s21c1
Sequence:CCGGGAGTTTACCAGTTGCCTAATACTCGAGTATTAGGCAACTGGTAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175061.3-968s21c1
Sequence:CCGGCAATAACATGCTGGTCATAACCTCGAGGTTATGACCAGCATGTTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-720s21c1
Sequence:CCGGTCAGCTCCATGTGCATGAATGCTCGAGCATTCATGCACATGGAGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-1758s21c1
Sequence:CCGGGCGGACCAAGATACCCATTTACTCGAGTAAATGGGTATCTTGGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175061.3-354s21c1
Sequence:CCGGTCGATACAGATCCACGGGTTTCTCGAGAAACCCGTGGATCTGTATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175061.3-764s21c1
Sequence:CCGGTGCCCAGTTCCTGGATGTAAACTCGAGTTTACATCCAGGAACTGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175061
VALIDATED
JAZF1 MISSION shRNA Lentiviral Transduction Particles
JAZF zinc finger 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175061.2-2592s1c1
Sequence:CCGGCGCTCTTTCTAGTGCAAGAAACTCGAGTTTCTTGCACTAGAAAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175061.2-187s1c1
Sequence:CCGGCAACCTATGTTGCCCTGAGTTCTCGAGAACTCAGGGCAACATAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175061.2-195s1c1
Sequence:CCGGGTTGCCCTGAGTTACATAAATCTCGAGATTTATGTAACTCAGGGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175061.2-698s1c1
Sequence:CCGGGCACCACACAATCAATTTCCACTCGAGTGGAAATTGATTGTGTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175061.2-695s1c1
Sequence:CCGGGCGGCACCACACAATCAATTTCTCGAGAAATTGATTGTGTGGTGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-269s21c1
Sequence:CCGGTTCTCCAATACCTGCCGATTCCTCGAGGAATCGGCAGGTATTGGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-937s21c1
Sequence:CCGGGGTGTCGGCTGAGATTATCAGCTCGAGCTGATAATCTCAGCCGACACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-828s21c1
Sequence:CCGGATGGTCACAGAACACAGATTCCTCGAGGAATCTGTGTTCTGTGACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-793s21c1
Sequence:CCGGCAAGAATGTGAATGGCATAAACTCGAGTTTATGCCATTCACATTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-2341s21c1
Sequence:CCGGGAGTTTACCAGTTGCCTAATACTCGAGTATTAGGCAACTGGTAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175061.3-968s21c1
Sequence:CCGGCAATAACATGCTGGTCATAACCTCGAGGTTATGACCAGCATGTTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-720s21c1
Sequence:CCGGTCAGCTCCATGTGCATGAATGCTCGAGCATTCATGCACATGGAGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175061.3-1758s21c1
Sequence:CCGGGCGGACCAAGATACCCATTTACTCGAGTAAATGGGTATCTTGGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175061.3-354s21c1
Sequence:CCGGTCGATACAGATCCACGGGTTTCTCGAGAAACCCGTGGATCTGTATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175061.3-764s21c1
Sequence:CCGGTGCCCAGTTCCTGGATGTAAACTCGAGTTTACATCCAGGAACTGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)