EMAIL THIS PAGE TO A FRIEND

JDP2

Jun dimerization protein 2

94 Gene Product Result for
Synonyms: JUNDM2
UniProtKB ID: Q8WYK2, J3KN58, O95430, Q9UIE4
Gene ID:
Mouse(81703) Jun dimerization protein 2
Rat(116674) Jun dimerization protein 2
Zebrafish(436766) Jun dimerization protein 2
domestic cat(101097736) Jun dimerization protein 2
cow(531476) Jun dimerization protein 2
dog(611936) Jun dimerization protein 2
chicken(423363) Jun dimerization protein 2
sheep(101108494) Jun dimerization protein 2
domestic guinea pig(100713847) Jun dimerization protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_130469 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130469 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130469 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU013311 MISSION® esiRNA esiRNA targeting mouse Jdp2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130469 Rosetta Predictions human pricing
NM_053894 Rosetta Predictions rat pricing
NM_030887 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023823 predicted 1092
2 SASI_Hs01_00023826 predicted 1122
3 SASI_Hs01_00023827 predicted 315
4 SASI_Hs01_00023828 predicted 1141
5 SASI_Hs01_00023830 predicted 502
6 SASI_Hs01_00023831 predicted 323
7 SASI_Hs01_00023832 predicted 1120
8 SASI_Hs02_00362766 predicted 316
9 SASI_Hs01_00023824 predicted 1122
10 SASI_Hs01_00023825 predicted 364
11 SASI_Hs01_00023829 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053894 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062582 predicted 523
2 SASI_Rn01_00062583 predicted 520
3 SASI_Rn01_00062584 predicted 408
4 SASI_Rn01_00062585 predicted 461
5 SASI_Rn01_00062586 predicted 455
6 SASI_Rn01_00062587 predicted 397
7 SASI_Rn01_00062588 predicted 414
8 SASI_Rn01_00062589 predicted 449
9 SASI_Rn01_00062590 predicted 512
10 SASI_Rn01_00062591 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044674 predicted 641
2 SASI_Mm01_00044675 predicted 514
3 SASI_Mm01_00044676 predicted 502
4 SASI_Mm01_00044677 predicted 825
5 SASI_Mm01_00044678 predicted 603
6 SASI_Mm01_00044679 predicted 1075
7 SASI_Mm01_00044680 predicted 606
8 SASI_Mm01_00044681 predicted 826
9 SASI_Mm01_00044682 predicted 1099
10 SASI_Mm01_00044683 predicted 363
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030887
VALIDATED
JDP2 MISSION shRNA Bacterial Glycerol Stock
Jun dimerization protein 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030887.2-709s21c1
Sequence:CCGGCTGGACAAGAAGTGACTGAAGCTCGAGCTTCAGTCACTTCTTGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030887.2-341s21c1
Sequence:CCGGACGCTGACATCCGCAACATTGCTCGAGCAATGTTGCGGATGTCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030887.2-566s21c1
Sequence:CCGGCAGAGCTGAAGACGCAGATAGCTCGAGCTATCTGCGTCTTCAGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030887.2-303s21c1
Sequence:CCGGACTTCCCAGCTCTGCTCTGACCTCGAGGTCAGAGCAGAGCTGGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030887.2-380s21c1
Sequence:CCGGTGCACTTCCTGGAGGTGAAACCTCGAGGTTTCACCTCCAGGAAGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030887.2-643s21c1
Sequence:CCGGACCTGCATCGTGCGCACAGATCTCGAGATCTGTGCGCACGATGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030887.2-525s21c1
Sequence:CCGGGTTTCTGCAGAGGGAGTCAGACTCGAGTCTGACTCCCTCTGCAGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030887.2-1250s1c1
Sequence:CCGGGCCCTTCCAAAGCACATACTTCTCGAGAAGTATGTGCTTTGGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030887.2-415s1c1
Sequence:CCGGCAACCCGTGAAGAGTGAGCTACTCGAGTAGCTCACTCTTCACGGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030887.2-492s1c1
Sequence:CCGGCAGATGCCGGAACAAGAAGAACTCGAGTTCTTCTTGTTCCGGCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030887.2-340s1c1
Sequence:CCGGTACGCTGACATCCGCAACATTCTCGAGAATGTTGCGGATGTCAGCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030887.2-606s1c1
Sequence:CCGGGCAACAGCTTATCCTGATGCTCTCGAGAGCATCAGGATAAGCTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030887
VALIDATED
JDP2 MISSION shRNA shRNA Plasmid DNA
Jun dimerization protein 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030887.2-709s21c1
Sequence:CCGGCTGGACAAGAAGTGACTGAAGCTCGAGCTTCAGTCACTTCTTGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030887.2-341s21c1
Sequence:CCGGACGCTGACATCCGCAACATTGCTCGAGCAATGTTGCGGATGTCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030887.2-566s21c1
Sequence:CCGGCAGAGCTGAAGACGCAGATAGCTCGAGCTATCTGCGTCTTCAGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030887.2-303s21c1
Sequence:CCGGACTTCCCAGCTCTGCTCTGACCTCGAGGTCAGAGCAGAGCTGGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030887.2-380s21c1
Sequence:CCGGTGCACTTCCTGGAGGTGAAACCTCGAGGTTTCACCTCCAGGAAGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030887.2-643s21c1
Sequence:CCGGACCTGCATCGTGCGCACAGATCTCGAGATCTGTGCGCACGATGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030887.2-525s21c1
Sequence:CCGGGTTTCTGCAGAGGGAGTCAGACTCGAGTCTGACTCCCTCTGCAGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030887.2-1250s1c1
Sequence:CCGGGCCCTTCCAAAGCACATACTTCTCGAGAAGTATGTGCTTTGGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030887.2-415s1c1
Sequence:CCGGCAACCCGTGAAGAGTGAGCTACTCGAGTAGCTCACTCTTCACGGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030887.2-492s1c1
Sequence:CCGGCAGATGCCGGAACAAGAAGAACTCGAGTTCTTCTTGTTCCGGCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030887.2-340s1c1
Sequence:CCGGTACGCTGACATCCGCAACATTCTCGAGAATGTTGCGGATGTCAGCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030887.2-606s1c1
Sequence:CCGGGCAACAGCTTATCCTGATGCTCTCGAGAGCATCAGGATAAGCTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030887
VALIDATED
JDP2 MISSION shRNA Lentiviral Transduction Particles
Jun dimerization protein 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030887.2-709s21c1
Sequence:CCGGCTGGACAAGAAGTGACTGAAGCTCGAGCTTCAGTCACTTCTTGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030887.2-341s21c1
Sequence:CCGGACGCTGACATCCGCAACATTGCTCGAGCAATGTTGCGGATGTCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030887.2-566s21c1
Sequence:CCGGCAGAGCTGAAGACGCAGATAGCTCGAGCTATCTGCGTCTTCAGCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030887.2-303s21c1
Sequence:CCGGACTTCCCAGCTCTGCTCTGACCTCGAGGTCAGAGCAGAGCTGGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030887.2-380s21c1
Sequence:CCGGTGCACTTCCTGGAGGTGAAACCTCGAGGTTTCACCTCCAGGAAGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030887.2-643s21c1
Sequence:CCGGACCTGCATCGTGCGCACAGATCTCGAGATCTGTGCGCACGATGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030887.2-525s21c1
Sequence:CCGGGTTTCTGCAGAGGGAGTCAGACTCGAGTCTGACTCCCTCTGCAGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030887.2-1250s1c1
Sequence:CCGGGCCCTTCCAAAGCACATACTTCTCGAGAAGTATGTGCTTTGGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030887.2-415s1c1
Sequence:CCGGCAACCCGTGAAGAGTGAGCTACTCGAGTAGCTCACTCTTCACGGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030887.2-492s1c1
Sequence:CCGGCAGATGCCGGAACAAGAAGAACTCGAGTTCTTCTTGTTCCGGCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030887.2-340s1c1
Sequence:CCGGTACGCTGACATCCGCAACATTCTCGAGAATGTTGCGGATGTCAGCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030887.2-606s1c1
Sequence:CCGGGCAACAGCTTATCCTGATGCTCTCGAGAGCATCAGGATAAGCTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130469
VALIDATED
JDP2 MISSION shRNA Bacterial Glycerol Stock
Jun dimerization protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_130469.3-481s21c1
Sequence:CCGGGAGGAAGAGGAGCGAAGGAAACTCGAGTTTCCTTCGCTCCTCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130469.3-363s21c1
Sequence:CCGGGACTGTGGAGGAGCTGAAATACTCGAGTATTTCAGCTCCTCCACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_130469.3-534s21c1
Sequence:CCGGCCGATGCCGGAACAAGAAGAACTCGAGTTCTTCTTGTTCCGGCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_130469.3-653s21c1
Sequence:CCGGAGCTCATCCTGATGCTGAACCCTCGAGGGTTCAGCATCAGGATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_130469.3-720s21c1
Sequence:CCGGCGAGTCAGAAGGCAACCCACTCTCGAGAGTGGGTTGCCTTCTGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130469.2-461s1c1
Sequence:CCGGCGGGAGAAGAACAAAGTCGCACTCGAGTGCGACTTTGTTCTTCTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_130469.2-316s1c1
Sequence:CCGGGACTGTGGAGGAGCTGAAATACTCGAGTATTTCAGCTCCTCCACAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_130469.2-673s1c1
Sequence:CCGGCGAGTCAGAAGGCAACCCACTCTCGAGAGTGGGTTGCCTTCTGACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_130469.2-550s1c1
Sequence:CCGGACTCATGAACGCAGAGCTGAACTCGAGTTCAGCTCTGCGTTCATGAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130469
VALIDATED
JDP2 MISSION shRNA shRNA Plasmid DNA
Jun dimerization protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_130469.3-481s21c1
Sequence:CCGGGAGGAAGAGGAGCGAAGGAAACTCGAGTTTCCTTCGCTCCTCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130469.3-363s21c1
Sequence:CCGGGACTGTGGAGGAGCTGAAATACTCGAGTATTTCAGCTCCTCCACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_130469.3-534s21c1
Sequence:CCGGCCGATGCCGGAACAAGAAGAACTCGAGTTCTTCTTGTTCCGGCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_130469.3-653s21c1
Sequence:CCGGAGCTCATCCTGATGCTGAACCCTCGAGGGTTCAGCATCAGGATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_130469.3-720s21c1
Sequence:CCGGCGAGTCAGAAGGCAACCCACTCTCGAGAGTGGGTTGCCTTCTGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130469.2-461s1c1
Sequence:CCGGCGGGAGAAGAACAAAGTCGCACTCGAGTGCGACTTTGTTCTTCTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_130469.2-316s1c1
Sequence:CCGGGACTGTGGAGGAGCTGAAATACTCGAGTATTTCAGCTCCTCCACAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_130469.2-673s1c1
Sequence:CCGGCGAGTCAGAAGGCAACCCACTCTCGAGAGTGGGTTGCCTTCTGACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_130469.2-550s1c1
Sequence:CCGGACTCATGAACGCAGAGCTGAACTCGAGTTCAGCTCTGCGTTCATGAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130469
VALIDATED
JDP2 MISSION shRNA Lentiviral Transduction Particles
Jun dimerization protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_130469.3-481s21c1
Sequence:CCGGGAGGAAGAGGAGCGAAGGAAACTCGAGTTTCCTTCGCTCCTCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130469.3-363s21c1
Sequence:CCGGGACTGTGGAGGAGCTGAAATACTCGAGTATTTCAGCTCCTCCACAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_130469.3-534s21c1
Sequence:CCGGCCGATGCCGGAACAAGAAGAACTCGAGTTCTTCTTGTTCCGGCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_130469.3-653s21c1
Sequence:CCGGAGCTCATCCTGATGCTGAACCCTCGAGGGTTCAGCATCAGGATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_130469.3-720s21c1
Sequence:CCGGCGAGTCAGAAGGCAACCCACTCTCGAGAGTGGGTTGCCTTCTGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130469.2-461s1c1
Sequence:CCGGCGGGAGAAGAACAAAGTCGCACTCGAGTGCGACTTTGTTCTTCTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_130469.2-316s1c1
Sequence:CCGGGACTGTGGAGGAGCTGAAATACTCGAGTATTTCAGCTCCTCCACAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_130469.2-673s1c1
Sequence:CCGGCGAGTCAGAAGGCAACCCACTCTCGAGAGTGGGTTGCCTTCTGACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_130469.2-550s1c1
Sequence:CCGGACTCATGAACGCAGAGCTGAACTCGAGTTCAGCTCTGCGTTCATGAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)