EMAIL THIS PAGE TO A FRIEND

JHDM1D

jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae)

323 Gene Product Result for
Synonyms: KDM7A
UniProtKB ID: Q6ZMT4, A4D1S9, C9JJH9, C9JQU2, Q6MZL8, Q9C0E5
Gene ID:
Mouse(338523) jumonji C domain-containing histone demethylase 1 homolog D (S. cerevisiae)
Rat(684297) jumonji C domain containing histone demethylase 1
chicken(418110) jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae)
dog(482769) jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae)
cow(521504) jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae)
Horse(100066113) jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae)
domestic cat(101091609) jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae)
sheep(101111627) jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae)
Domestic Rabbit(100338358) jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae)
domestic guinea pig(100718883) jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae)
naked mole-rat(101699351) jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030647 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033430 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033430 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033430 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030647 Rosetta Predictions human pricing
XM_001069774 Rosetta Predictions rat pricing
NM_001033430 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217909 predicted 932
2 SASI_Hs02_00358223 predicted 2441
3 SASI_Hs01_00217910 predicted 844
4 SASI_Hs01_00217911 predicted 2793
5 SASI_Hs01_00217912 predicted 350
6 SASI_Hs01_00217913 predicted 2319
7 SASI_Hs01_00217914 predicted 2910
8 SASI_Hs01_00217915 predicted 833
9 SASI_Hs01_00217917 predicted 2088
10 SASI_Hs02_00358224 predicted 2806
11 SASI_Hs01_00217916 predicted 1717
12 SASI_Hs01_00217918 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329233 predicted 1568
2 SASI_Rn02_00329234 predicted 2448
3 SASI_Rn02_00329235 predicted 2723
4 SASI_Rn02_00329236 predicted 2023
5 SASI_Rn02_00329237 predicted 1908
6 SASI_Rn02_00329238 predicted 1221
7 SASI_Rn02_00329239 predicted 2189
8 SASI_Rn02_00329240 predicted 675
9 SASI_Rn02_00329241 predicted 569
10 SASI_Rn02_00329242 predicted 2198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073176 predicted 1878
2 SASI_Mm01_00073177 predicted 1643
3 SASI_Mm02_00288742 predicted 753
4 SASI_Mm01_00073179 predicted 1077
5 SASI_Mm01_00073180 predicted 1237
6 SASI_Mm01_00073181 predicted 1845
7 SASI_Mm01_00073182 predicted 1517
8 SASI_Mm01_00073183 predicted 594
9 SASI_Mm01_00073184 predicted 1533
10 SASI_Mm01_00073185 predicted 611
11 SASI_Mm01_00073178 predicted 542
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030647
VALIDATED
JHDM1D MISSION shRNA Bacterial Glycerol Stock
jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030647.1-2344s21c1
Sequence:CCGGGCAGTTGTATCGCTATGATAACTCGAGTTATCATAGCGATACAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030647.1-466s21c1
Sequence:CCGGTGGATTTGATGTCCCTATTATCTCGAGATAATAGGGACATCAAATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030647.1-1380s21c1
Sequence:CCGGTTAGACCTGGACACCTTATTACTCGAGTAATAAGGTGTCCAGGTCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030647.1-515s21c1
Sequence:CCGGAGGCTCCCTTCACCTACATTTCTCGAGAAATGTAGGTGAAGGGAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030647.1-5893s21c1
Sequence:CCGGTATGGGATCAACAGGTATTTACTCGAGTAAATACCTGTTGATCCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030647
VALIDATED
JHDM1D MISSION shRNA shRNA Plasmid DNA
jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030647.1-2344s21c1
Sequence:CCGGGCAGTTGTATCGCTATGATAACTCGAGTTATCATAGCGATACAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030647.1-466s21c1
Sequence:CCGGTGGATTTGATGTCCCTATTATCTCGAGATAATAGGGACATCAAATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030647.1-1380s21c1
Sequence:CCGGTTAGACCTGGACACCTTATTACTCGAGTAATAAGGTGTCCAGGTCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030647.1-515s21c1
Sequence:CCGGAGGCTCCCTTCACCTACATTTCTCGAGAAATGTAGGTGAAGGGAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030647.1-5893s21c1
Sequence:CCGGTATGGGATCAACAGGTATTTACTCGAGTAAATACCTGTTGATCCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030647
VALIDATED
JHDM1D MISSION shRNA Lentiviral Transduction Particles
jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030647.1-2344s21c1
Sequence:CCGGGCAGTTGTATCGCTATGATAACTCGAGTTATCATAGCGATACAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030647.1-466s21c1
Sequence:CCGGTGGATTTGATGTCCCTATTATCTCGAGATAATAGGGACATCAAATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030647.1-1380s21c1
Sequence:CCGGTTAGACCTGGACACCTTATTACTCGAGTAATAAGGTGTCCAGGTCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030647.1-515s21c1
Sequence:CCGGAGGCTCCCTTCACCTACATTTCTCGAGAAATGTAGGTGAAGGGAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030647.1-5893s21c1
Sequence:CCGGTATGGGATCAACAGGTATTTACTCGAGTAAATACCTGTTGATCCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033430
JHDM1D MISSION shRNA Bacterial Glycerol Stock
jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033430.4-601s21c1
Sequence:CCGGTGGATTTGATGTCCCTATTATCTCGAGATAATAGGGACATCAAATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033430.4-5869s21c1
Sequence:CCGGTAAGAGATCAGCAGGTATTATCTCGAGATAATACCTGCTGATCTCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033430.4-1513s21c1
Sequence:CCGGTGTTAGACCTGGGCATCTTATCTCGAGATAAGATGCCCAGGTCTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033430.4-2369s21c1
Sequence:CCGGTTGCACTATTCCTCGTGTTTACTCGAGTAAACACGAGGAATAGTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033430.4-2572s21c1
Sequence:CCGGTGATCGAACTTCCAGATTTAACTCGAGTTAAATCTGGAAGTTCGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033430
JHDM1D MISSION shRNA shRNA Plasmid DNA
jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033430.4-601s21c1
Sequence:CCGGTGGATTTGATGTCCCTATTATCTCGAGATAATAGGGACATCAAATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033430.4-5869s21c1
Sequence:CCGGTAAGAGATCAGCAGGTATTATCTCGAGATAATACCTGCTGATCTCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033430.4-1513s21c1
Sequence:CCGGTGTTAGACCTGGGCATCTTATCTCGAGATAAGATGCCCAGGTCTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033430.4-2369s21c1
Sequence:CCGGTTGCACTATTCCTCGTGTTTACTCGAGTAAACACGAGGAATAGTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033430.4-2572s21c1
Sequence:CCGGTGATCGAACTTCCAGATTTAACTCGAGTTAAATCTGGAAGTTCGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033430
JHDM1D MISSION shRNA Lentiviral Transduction Particles
jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033430.4-601s21c1
Sequence:CCGGTGGATTTGATGTCCCTATTATCTCGAGATAATAGGGACATCAAATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033430.4-5869s21c1
Sequence:CCGGTAAGAGATCAGCAGGTATTATCTCGAGATAATACCTGCTGATCTCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033430.4-1513s21c1
Sequence:CCGGTGTTAGACCTGGGCATCTTATCTCGAGATAAGATGCCCAGGTCTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033430.4-2369s21c1
Sequence:CCGGTTGCACTATTCCTCGTGTTTACTCGAGTAAACACGAGGAATAGTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033430.4-2572s21c1
Sequence:CCGGTGATCGAACTTCCAGATTTAACTCGAGTTAAATCTGGAAGTTCGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)