EMAIL THIS PAGE TO A FRIEND

JKAMP

JNK1/MAPK8-associated membrane protein

67 Gene Product Result for
Synonyms: C14orf100 HSPC213 HSPC327 JAMP
Gene ID:
Mouse(104771) JNK1/MAPK8-associated membrane protein
Rat(299127) JNK1/MAPK8-associated membrane protein
Zebrafish(393454) jnk1/mapk8-associated membrane protein
chicken(423530) JNK1/MAPK8-associated membrane protein
cow(509181) JNK1/MAPK8-associated membrane protein
domestic cat(101099216) JNK1/MAPK8-associated membrane protein
dog(490716) JNK1/MAPK8-associated membrane protein
domestic guinea pig(100728540) JNK1/MAPK8-associated membrane protein
naked mole-rat(101724592) JNK1/MAPK8-associated membrane protein
sheep(101102487) JNK1/MAPK8-associated membrane protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024205 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024205 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024205 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016475 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098625 Rosetta Predictions human pricing
NM_016475 Rosetta Predictions human pricing
NM_001106738 Rosetta Predictions rat pricing
XM_216728 Rosetta Predictions rat pricing
NM_024205 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319556 predicted 851
2 SASI_Hs02_00319557 predicted 1038
3 SASI_Hs02_00319558 predicted 487
4 SASI_Hs02_00319559 predicted 1154
5 SASI_Hs02_00319560 predicted 900
6 SASI_Hs02_00319561 predicted 429
7 SASI_Hs02_00319562 predicted 431
8 SASI_Hs02_00319563 predicted 970
9 SASI_Hs02_00319564 predicted 451
10 SASI_Hs02_00319565 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349524 predicted 865
2 SASI_Hs01_00235267 predicted 1053
3 SASI_Hs01_00235270 predicted 501
4 SASI_Hs01_00235271 predicted 1178
5 SASI_Hs01_00235273 predicted 917
6 SASI_Hs01_00235274 predicted 446
7 SASI_Hs01_00235275 predicted 449
8 SASI_Hs02_00349525 predicted 988
9 SASI_Hs02_00349526 predicted 468
10 SASI_Hs02_00349527 predicted 442
11 SASI_Hs01_00235266 predicted 240
12 SASI_Hs01_00235268 predicted 500
13 SASI_Hs01_00235269 predicted 733
14 SASI_Hs01_00235272 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106738 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221908 predicted 882
2 SASI_Rn02_00221909 predicted 992
3 SASI_Rn02_00221910 predicted 778
4 SASI_Rn02_00221911 predicted 512
5 SASI_Rn02_00221912 predicted 350
6 SASI_Rn02_00221913 predicted 409
7 SASI_Rn02_00221914 predicted 547
8 SASI_Rn02_00221915 predicted 988
9 SASI_Rn02_00221916 predicted 971
10 SASI_Rn02_00221917 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216728 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00151714 predicted 703
2 SASI_Rn01_00151715 predicted 1723
3 SASI_Rn01_00151716 predicted 1041
4 SASI_Rn01_00151717 predicted 996
5 SASI_Rn01_00151718 predicted 752
6 SASI_Rn01_00151719 predicted 1523
7 SASI_Rn01_00151720 predicted 1553
8 SASI_Rn01_00151721 predicted 702
9 SASI_Rn01_00151722 predicted 406
10 SASI_Rn01_00151723 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024205 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163535 predicted 229
2 SASI_Mm01_00163536 predicted 377
3 SASI_Mm01_00163537 predicted 240
4 SASI_Mm01_00163539 predicted 537
5 SASI_Mm02_00327561 predicted 743
6 SASI_Mm01_00163540 predicted 628
7 SASI_Mm01_00163541 predicted 504
8 SASI_Mm01_00163542 predicted 600
9 SASI_Mm01_00163543 predicted 464
10 SASI_Mm01_00163544 predicted 416
11 SASI_Mm01_00163538 predicted 708
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024205
VALIDATED
JKAMP MISSION shRNA Bacterial Glycerol Stock
JNK1/MAPK8-associated membrane protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024205.1-842s1c1
Sequence:CCGGCCTATGGCATAGTCTCCATCTCTCGAGAGATGGAGACTATGCCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024205.1-96s21c1
Sequence:CCGGCTGTGGGAAGACCCTATTATTCTCGAGAATAATAGGGTCTTCCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024205.1-766s1c1
Sequence:CCGGGAAATAGAGAACTGCTATGATCTCGAGATCATAGCAGTTCTCTATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024205.1-693s1c1
Sequence:CCGGCTTATATTACGCCTTCCCGTACTCGAGTACGGGAAGGCGTAATATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024205.1-96s1c1
Sequence:CCGGCTGTGGGAAGACCCTATTATTCTCGAGAATAATAGGGTCTTCCCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024205.1-732s21c1
Sequence:CCGGTCTGGTTACCCTGGCTGTATACTCGAGTATACAGCCAGGGTAACCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024205.1-229s21c1
Sequence:CCGGTGGCTCTATCTGGGCTTTATGCTCGAGCATAAAGCCCAGATAGAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024205.1-539s21c1
Sequence:CCGGACGCGTTCTGCTTGGTGTTAACTCGAGTTAACACCAAGCAGAACGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024205.1-698s21c1
Sequence:CCGGATTACGCCTTCCCGTACATTACTCGAGTAATGTACGGGAAGGCGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024205
VALIDATED
JKAMP MISSION shRNA shRNA Plasmid DNA
JNK1/MAPK8-associated membrane protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024205.1-842s1c1
Sequence:CCGGCCTATGGCATAGTCTCCATCTCTCGAGAGATGGAGACTATGCCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024205.1-96s21c1
Sequence:CCGGCTGTGGGAAGACCCTATTATTCTCGAGAATAATAGGGTCTTCCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024205.1-766s1c1
Sequence:CCGGGAAATAGAGAACTGCTATGATCTCGAGATCATAGCAGTTCTCTATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024205.1-693s1c1
Sequence:CCGGCTTATATTACGCCTTCCCGTACTCGAGTACGGGAAGGCGTAATATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024205.1-96s1c1
Sequence:CCGGCTGTGGGAAGACCCTATTATTCTCGAGAATAATAGGGTCTTCCCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024205.1-732s21c1
Sequence:CCGGTCTGGTTACCCTGGCTGTATACTCGAGTATACAGCCAGGGTAACCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024205.1-229s21c1
Sequence:CCGGTGGCTCTATCTGGGCTTTATGCTCGAGCATAAAGCCCAGATAGAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024205.1-539s21c1
Sequence:CCGGACGCGTTCTGCTTGGTGTTAACTCGAGTTAACACCAAGCAGAACGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024205.1-698s21c1
Sequence:CCGGATTACGCCTTCCCGTACATTACTCGAGTAATGTACGGGAAGGCGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024205
VALIDATED
JKAMP MISSION shRNA Lentiviral Transduction Particles
JNK1/MAPK8-associated membrane protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024205.1-842s1c1
Sequence:CCGGCCTATGGCATAGTCTCCATCTCTCGAGAGATGGAGACTATGCCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024205.1-96s21c1
Sequence:CCGGCTGTGGGAAGACCCTATTATTCTCGAGAATAATAGGGTCTTCCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024205.1-766s1c1
Sequence:CCGGGAAATAGAGAACTGCTATGATCTCGAGATCATAGCAGTTCTCTATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024205.1-693s1c1
Sequence:CCGGCTTATATTACGCCTTCCCGTACTCGAGTACGGGAAGGCGTAATATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024205.1-96s1c1
Sequence:CCGGCTGTGGGAAGACCCTATTATTCTCGAGAATAATAGGGTCTTCCCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024205.1-732s21c1
Sequence:CCGGTCTGGTTACCCTGGCTGTATACTCGAGTATACAGCCAGGGTAACCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024205.1-229s21c1
Sequence:CCGGTGGCTCTATCTGGGCTTTATGCTCGAGCATAAAGCCCAGATAGAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024205.1-539s21c1
Sequence:CCGGACGCGTTCTGCTTGGTGTTAACTCGAGTTAACACCAAGCAGAACGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024205.1-698s21c1
Sequence:CCGGATTACGCCTTCCCGTACATTACTCGAGTAATGTACGGGAAGGCGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016475
VALIDATED
JKAMP MISSION shRNA Bacterial Glycerol Stock
JNK1/MAPK8-associated membrane protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016475.2-979s1c1
Sequence:CCGGCCGAACCTTCAAGGATACTCTCTCGAGAGAGTATCCTTGAAGGTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016475.2-1403s1c1
Sequence:CCGGCCTGTTGTGTTTCAGTTTGTTCTCGAGAACAAACTGAAACACAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016475.2-233s1c1
Sequence:CCGGCACAGAATCTCCTGAACTTTACTCGAGTAAAGTTCAGGAGATTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016475.3-495s21c1
Sequence:CCGGTATTCGTTCATGTCGAGTATTCTCGAGAATACTCGACATGAACGAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016475.2-808s1c1
Sequence:CCGGGCTATGATCTTCTGGTCAGAACTCGAGTTCTGACCAGAAGATCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016475.2-1388s1c1
Sequence:CCGGGCGTAATTGTACGTACCTGTTCTCGAGAACAGGTACGTACAATTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016475.2-669s1c1
Sequence:CCGGGCACTTTACTTCTTCCCAATTCTCGAGAATTGGGAAGAAGTAAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016475.3-630s21c1
Sequence:CCGGCGCATTCTGCTTGGTATTAATCTCGAGATTAATACCAAGCAGAATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016475.3-1180s21c1
Sequence:CCGGGAACAAGATTGTCAGTATATCCTCGAGGATATACTGACAATCTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016475.3-1274s21c1
Sequence:CCGGCTCTGTTACACAGGGTAATATCTCGAGATATTACCCTGTGTAACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016475.2-387s1c1
Sequence:CCGGGCAGCTATTATCACCTTACTTCTCGAGAAGTAAGGTGATAATAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016475
VALIDATED
JKAMP MISSION shRNA shRNA Plasmid DNA
JNK1/MAPK8-associated membrane protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016475.2-979s1c1
Sequence:CCGGCCGAACCTTCAAGGATACTCTCTCGAGAGAGTATCCTTGAAGGTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016475.2-1403s1c1
Sequence:CCGGCCTGTTGTGTTTCAGTTTGTTCTCGAGAACAAACTGAAACACAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016475.2-233s1c1
Sequence:CCGGCACAGAATCTCCTGAACTTTACTCGAGTAAAGTTCAGGAGATTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016475.3-495s21c1
Sequence:CCGGTATTCGTTCATGTCGAGTATTCTCGAGAATACTCGACATGAACGAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016475.2-808s1c1
Sequence:CCGGGCTATGATCTTCTGGTCAGAACTCGAGTTCTGACCAGAAGATCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016475.2-1388s1c1
Sequence:CCGGGCGTAATTGTACGTACCTGTTCTCGAGAACAGGTACGTACAATTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016475.2-669s1c1
Sequence:CCGGGCACTTTACTTCTTCCCAATTCTCGAGAATTGGGAAGAAGTAAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016475.3-630s21c1
Sequence:CCGGCGCATTCTGCTTGGTATTAATCTCGAGATTAATACCAAGCAGAATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016475.3-1180s21c1
Sequence:CCGGGAACAAGATTGTCAGTATATCCTCGAGGATATACTGACAATCTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016475.3-1274s21c1
Sequence:CCGGCTCTGTTACACAGGGTAATATCTCGAGATATTACCCTGTGTAACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016475.2-387s1c1
Sequence:CCGGGCAGCTATTATCACCTTACTTCTCGAGAAGTAAGGTGATAATAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016475
VALIDATED
JKAMP MISSION shRNA Lentiviral Transduction Particles
JNK1/MAPK8-associated membrane protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016475.2-979s1c1
Sequence:CCGGCCGAACCTTCAAGGATACTCTCTCGAGAGAGTATCCTTGAAGGTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016475.2-1403s1c1
Sequence:CCGGCCTGTTGTGTTTCAGTTTGTTCTCGAGAACAAACTGAAACACAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016475.2-233s1c1
Sequence:CCGGCACAGAATCTCCTGAACTTTACTCGAGTAAAGTTCAGGAGATTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016475.3-495s21c1
Sequence:CCGGTATTCGTTCATGTCGAGTATTCTCGAGAATACTCGACATGAACGAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016475.2-808s1c1
Sequence:CCGGGCTATGATCTTCTGGTCAGAACTCGAGTTCTGACCAGAAGATCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016475.2-1388s1c1
Sequence:CCGGGCGTAATTGTACGTACCTGTTCTCGAGAACAGGTACGTACAATTACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016475.2-669s1c1
Sequence:CCGGGCACTTTACTTCTTCCCAATTCTCGAGAATTGGGAAGAAGTAAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016475.3-630s21c1
Sequence:CCGGCGCATTCTGCTTGGTATTAATCTCGAGATTAATACCAAGCAGAATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016475.3-1180s21c1
Sequence:CCGGGAACAAGATTGTCAGTATATCCTCGAGGATATACTGACAATCTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016475.3-1274s21c1
Sequence:CCGGCTCTGTTACACAGGGTAATATCTCGAGATATTACCCTGTGTAACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016475.2-387s1c1
Sequence:CCGGGCAGCTATTATCACCTTACTTCTCGAGAAGTAAGGTGATAATAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)