EMAIL THIS PAGE TO A FRIEND

JMJD1C

jumonji domain containing 1C

154 Gene Product Result for
Synonyms: RP11-10C13.2 TRIP8
Gene ID:
Mouse(108829) jumonji domain containing 1C
Rat(171120) jumonji domain containing 1C
chicken(423655) jumonji domain containing 1C
cow(781067) jumonji domain containing 1C
dog(479221) jumonji domain containing 1C
domestic cat(101083035) jumonji domain containing 1C
Horse(100072442) jumonji domain containing 1C
sheep(101123089) jumonji domain containing 1C
Domestic Rabbit(100350438) jumonji domain containing 1C
domestic guinea pig(100724491) jumonji domain containing 1C
naked mole-rat(101710633) jumonji domain containing 1C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004241 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_907708 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_907708 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_907708 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004241 Rosetta Predictions human pricing
NM_032776 Rosetta Predictions human pricing
XM_001080424 Rosetta Predictions rat pricing
XM_228122 Rosetta Predictions rat pricing
XM_907708 Rosetta Predictions mouse pricing
XM_975833 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022991 predicted 4932
2 SASI_Hs01_00022992 predicted 5202
3 SASI_Hs01_00022995 predicted 770
4 SASI_Hs01_00022996 predicted 4626
5 SASI_Hs02_00337176 predicted 4589
6 SASI_Hs01_00022998 predicted 2752
7 SASI_Hs01_00022999 predicted 1618
8 SASI_Hs02_00337177 predicted 2219
9 SASI_Hs01_00023000 predicted 1720
10 SASI_Hs02_00337178 predicted 2900
11 SASI_Hs01_00022993 predicted 2030
12 SASI_Hs01_00022994 predicted 5439
13 SASI_Hs01_00022997 predicted 6988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032776 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360313 predicted 5231
2 SASI_Hs02_00360314 predicted 5495
3 SASI_Hs02_00360315 predicted 1066
4 SASI_Hs02_00360316 predicted 4926
5 SASI_Hs02_00360317 predicted 4877
6 SASI_Hs02_00360318 predicted 3039
7 SASI_Hs02_00360319 predicted 1909
8 SASI_Hs02_00360320 predicted 2511
9 SASI_Hs02_00360321 predicted 2012
10 SASI_Hs02_00360322 predicted 3193
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080424 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367959 predicted 7226
2 SASI_Rn02_00367960 predicted 1031
3 SASI_Rn02_00367961 predicted 4585
4 SASI_Rn02_00367962 predicted 3506
5 SASI_Rn02_00367963 predicted 4947
6 SASI_Rn02_00367964 predicted 5421
7 SASI_Rn02_00367965 predicted 3321
8 SASI_Rn02_00367966 predicted 2816
9 SASI_Rn02_00367967 predicted 700
10 SASI_Rn02_00367968 predicted 2725
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384931 predicted 7225
2 SASI_Rn02_00384932 predicted 1030
3 SASI_Rn02_00384933 predicted 4587
4 SASI_Rn02_00384934 predicted 3505
5 SASI_Rn02_00384935 predicted 4940
6 SASI_Rn02_00384936 predicted 5422
7 SASI_Rn02_00384937 predicted 3326
8 SASI_Rn02_00384938 predicted 2809
9 SASI_Rn02_00384939 predicted 692
10 SASI_Rn02_00384940 predicted 2729
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907708 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433499 predicted 6417
2 SASI_Mm02_00433500 predicted 4606
3 SASI_Mm02_00433501 predicted 1743
4 SASI_Mm02_00433502 predicted 2746
5 SASI_Mm02_00433503 predicted 2283
6 SASI_Mm02_00433504 predicted 3116
7 SASI_Mm02_00433505 predicted 3266
8 SASI_Mm02_00433506 predicted 3773
9 SASI_Mm02_00433507 predicted 2468
10 SASI_Mm02_00433508 predicted 1513
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975833 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00445784 predicted 5385
2 SASI_Mm01_00261443 predicted 7105
3 SASI_Mm01_00261444 predicted 4601
4 SASI_Mm01_00261445 predicted 7514
5 SASI_Mm01_00261446 predicted 5374
6 SASI_Mm01_00261447 predicted 4689
7 SASI_Mm01_00261448 predicted 7570
8 SASI_Mm01_00261449 predicted 5395
9 SASI_Mm01_00261451 predicted 7164
10 SASI_Mm02_00445785 predicted 4738
11 SASI_Mm01_00261450 predicted 5450
12 SASI_Mm01_00261452 predicted 7559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004241
VALIDATED
JMJD1C MISSION shRNA Bacterial Glycerol Stock
jumonji domain containing 1C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004241.2-7744s1c1
Sequence:CCGGGCTCCTGTGATTCAATGTTATCTCGAGATAACATTGAATCACAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004241.2-3928s1c1
Sequence:CCGGGCGTCCATCTTCTAGTACAAACTCGAGTTTGTACTAGAAGATGGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004241.2-2292s1c1
Sequence:CCGGCCCATTTACTAGCCGGATCATCTCGAGATGATCCGGCTAGTAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004241.2-6851s1c1
Sequence:CCGGGCCTCTCATTTGCCAGGATTTCTCGAGAAATCCTGGCAAATGAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004241.2-6575s1c1
Sequence:CCGGGCGGAATCAATTAGTCTTGATCTCGAGATCAAGACTAATTGATTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004241.2-6435s21c1
Sequence:CCGGGGATCTGTGAGAAGCATATTTCTCGAGAAATATGCTTCTCACAGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004241.2-1858s21c1
Sequence:CCGGTCCACCTCCAGAGACTATAAACTCGAGTTTATAGTCTCTGGAGGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004241.2-3827s21c1
Sequence:CCGGGAGATGTGGAGACCTAATAATCTCGAGATTATTAGGTCTCCACATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004241
VALIDATED
JMJD1C MISSION shRNA shRNA Plasmid DNA
jumonji domain containing 1C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004241.2-7744s1c1
Sequence:CCGGGCTCCTGTGATTCAATGTTATCTCGAGATAACATTGAATCACAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004241.2-3928s1c1
Sequence:CCGGGCGTCCATCTTCTAGTACAAACTCGAGTTTGTACTAGAAGATGGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004241.2-2292s1c1
Sequence:CCGGCCCATTTACTAGCCGGATCATCTCGAGATGATCCGGCTAGTAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004241.2-6851s1c1
Sequence:CCGGGCCTCTCATTTGCCAGGATTTCTCGAGAAATCCTGGCAAATGAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004241.2-6575s1c1
Sequence:CCGGGCGGAATCAATTAGTCTTGATCTCGAGATCAAGACTAATTGATTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004241.2-6435s21c1
Sequence:CCGGGGATCTGTGAGAAGCATATTTCTCGAGAAATATGCTTCTCACAGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004241.2-1858s21c1
Sequence:CCGGTCCACCTCCAGAGACTATAAACTCGAGTTTATAGTCTCTGGAGGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004241.2-3827s21c1
Sequence:CCGGGAGATGTGGAGACCTAATAATCTCGAGATTATTAGGTCTCCACATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004241
VALIDATED
JMJD1C MISSION shRNA Lentiviral Transduction Particles
jumonji domain containing 1C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004241.2-7744s1c1
Sequence:CCGGGCTCCTGTGATTCAATGTTATCTCGAGATAACATTGAATCACAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004241.2-3928s1c1
Sequence:CCGGGCGTCCATCTTCTAGTACAAACTCGAGTTTGTACTAGAAGATGGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004241.2-2292s1c1
Sequence:CCGGCCCATTTACTAGCCGGATCATCTCGAGATGATCCGGCTAGTAAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004241.2-6851s1c1
Sequence:CCGGGCCTCTCATTTGCCAGGATTTCTCGAGAAATCCTGGCAAATGAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004241.2-6575s1c1
Sequence:CCGGGCGGAATCAATTAGTCTTGATCTCGAGATCAAGACTAATTGATTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004241.2-6435s21c1
Sequence:CCGGGGATCTGTGAGAAGCATATTTCTCGAGAAATATGCTTCTCACAGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004241.2-1858s21c1
Sequence:CCGGTCCACCTCCAGAGACTATAAACTCGAGTTTATAGTCTCTGGAGGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004241.2-3827s21c1
Sequence:CCGGGAGATGTGGAGACCTAATAATCTCGAGATTATTAGGTCTCCACATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_907708
VALIDATED
JMJD1C MISSION shRNA Bacterial Glycerol Stock
jumonji domain containing 1C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_907708.3-7735s21c1
Sequence:CCGGTGATTCAATGCTAGCTATAAACTCGAGTTTATAGCTAGCATTGAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_907708.3-7131s21c1
Sequence:CCGGTGGTGCTCTATGGCATATTTACTCGAGTAAATATGCCATAGAGCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_907708.3-3253s21c1
Sequence:CCGGAGTAACTACTTCACTACTTTACTCGAGTAAAGTAGTGAAGTAGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_907708.3-182s21c1
Sequence:CCGGATGACCTTGAGTGGGATAAACCTCGAGGTTTATCCCACTCAAGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_907708.3-160s21c1
Sequence:CCGGCTGGCGGTCTACGTGGAATTTCTCGAGAAATTCCACGTAGACCGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_907708
VALIDATED
JMJD1C MISSION shRNA shRNA Plasmid DNA
jumonji domain containing 1C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_907708.3-7735s21c1
Sequence:CCGGTGATTCAATGCTAGCTATAAACTCGAGTTTATAGCTAGCATTGAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_907708.3-7131s21c1
Sequence:CCGGTGGTGCTCTATGGCATATTTACTCGAGTAAATATGCCATAGAGCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_907708.3-3253s21c1
Sequence:CCGGAGTAACTACTTCACTACTTTACTCGAGTAAAGTAGTGAAGTAGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_907708.3-182s21c1
Sequence:CCGGATGACCTTGAGTGGGATAAACCTCGAGGTTTATCCCACTCAAGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_907708.3-160s21c1
Sequence:CCGGCTGGCGGTCTACGTGGAATTTCTCGAGAAATTCCACGTAGACCGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_907708
VALIDATED
JMJD1C MISSION shRNA Lentiviral Transduction Particles
jumonji domain containing 1C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_907708.3-7735s21c1
Sequence:CCGGTGATTCAATGCTAGCTATAAACTCGAGTTTATAGCTAGCATTGAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_907708.3-7131s21c1
Sequence:CCGGTGGTGCTCTATGGCATATTTACTCGAGTAAATATGCCATAGAGCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_907708.3-3253s21c1
Sequence:CCGGAGTAACTACTTCACTACTTTACTCGAGTAAAGTAGTGAAGTAGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_907708.3-182s21c1
Sequence:CCGGATGACCTTGAGTGGGATAAACCTCGAGGTTTATCCCACTCAAGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_907708.3-160s21c1
Sequence:CCGGCTGGCGGTCTACGTGGAATTTCTCGAGAAATTCCACGTAGACCGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)