EMAIL THIS PAGE TO A FRIEND

JMJD4

jumonji domain containing 4

161 Gene Product Result for
UniProtKB ID: Q9H9V9, Q5TBZ1, Q5TBZ6, Q9H970
Gene ID:
Mouse(194952) jumonji domain containing 4
Rat(287359) jumonji domain containing 4
Zebrafish(767690) jumonji domain containing 4
chicken(420400) jumonji domain containing 4
cow(506151) jumonji domain containing 4
dog(475182) jumonji domain containing 4
domestic cat(101100782) jumonji domain containing 4
domestic guinea pig(100722200) jumonji domain containing 4
naked mole-rat(101715125) jumonji domain containing 4
sheep(101103319) jumonji domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023007 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023007 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023007 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178659 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178659 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178659 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153881 MISSION® esiRNA esiRNA human JMJD4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023007 Rosetta Predictions human pricing
NM_001105784 Rosetta Predictions rat pricing
NM_178659 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053630 predicted 1238
2 SASI_Hs01_00053631 predicted 475
3 SASI_Hs01_00053633 predicted 1122
4 SASI_Hs01_00053635 predicted 1233
5 SASI_Hs02_00356265 predicted 1720
6 SASI_Hs01_00053638 predicted 1576
7 SASI_Hs02_00356266 predicted 1399
8 SASI_Hs02_00356267 predicted 465
9 SASI_Hs02_00356268 predicted 384
10 SASI_Hs02_00356269 predicted 1386
11 SASI_Hs01_00053632 predicted 642
12 SASI_Hs01_00053634 predicted 916
13 SASI_Hs01_00053636 predicted 597
14 SASI_Hs01_00053637 predicted 638
15 SASI_Hs01_00053639 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105784 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212496 predicted 220
2 SASI_Rn02_00212497 predicted 210
3 SASI_Rn02_00212498 predicted 618
4 SASI_Rn02_00212499 predicted 330
5 SASI_Rn02_00212500 predicted 587
6 SASI_Rn02_00212501 predicted 430
7 SASI_Rn02_00212502 predicted 754
8 SASI_Rn02_00212503 predicted 336
9 SASI_Rn02_00212504 predicted 871
10 SASI_Rn02_00212505 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120867 predicted 1433
2 SASI_Mm01_00120868 predicted 499
3 SASI_Mm01_00120869 predicted 283
4 SASI_Mm01_00120870 predicted 767
5 SASI_Mm01_00120872 predicted 994
6 SASI_Mm01_00120873 predicted 670
7 SASI_Mm01_00120874 predicted 481
8 SASI_Mm01_00120875 predicted 1342
9 SASI_Mm01_00120876 predicted 310
10 SASI_Mm02_00349104 predicted 1138
11 SASI_Mm01_00120871 predicted 1004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023007
VALIDATED
JMJD4 MISSION shRNA Bacterial Glycerol Stock
jumonji domain containing 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023007.1-394s21c1
Sequence:CCGGACCTACGGAGACGTGGTTGTACTCGAGTACAACCACGTCTCCGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_023007.1-977s21c1
Sequence:CCGGTCAACCACAACTGGGTCAATGCTCGAGCATTGACCCAGTTGTGGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023007.1-1718s21c1
Sequence:CCGGTCTGGTGGCTCCTCTTAATAGCTCGAGCTATTAAGAGGAGCCACCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_023007.1-722s21c1
Sequence:CCGGCCTTCAGCTGGTCTGTCAATGCTCGAGCATTGACAGACCAGCTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_023007.1-647s21c1
Sequence:CCGGATGTGGATGACTACCGCTTTGCTCGAGCAAAGCGGTAGTCATCCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138765    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023007.1-2010s1c1
Sequence:CCGGGAATCCCATCTGCTGCTGAATCTCGAGATTCAGCAGCAGATGGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023007.1-405s1c1
Sequence:CCGGCGTGGTTGTACCAGTTGCAAACTCGAGTTTGCAACTGGTACAACCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_023007.1-462s1c1
Sequence:CCGGGCACATGACTCTCAGAGACTACTCGAGTAGTCTCTGAGAGTCATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023007.1-738s1c1
Sequence:CCGGCAATGTCTGTGGGAGGAAGAACTCGAGTTCTTCCTCCCACAGACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_023007.1-646s1c1
Sequence:CCGGGATGTGGATGACTACCGCTTTCTCGAGAAAGCGGTAGTCATCCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023007.1-2122s1c1
Sequence:CCGGCCTCTTCACACTGGGTATGATCTCGAGATCATACCCAGTGTGAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023007.1-2259s1c1
Sequence:CCGGCCTCTAGTGGATCCACAGTTTCTCGAGAAACTGTGGATCCACTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023007
VALIDATED
JMJD4 MISSION shRNA shRNA Plasmid DNA
jumonji domain containing 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023007.1-394s21c1
Sequence:CCGGACCTACGGAGACGTGGTTGTACTCGAGTACAACCACGTCTCCGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_023007.1-977s21c1
Sequence:CCGGTCAACCACAACTGGGTCAATGCTCGAGCATTGACCCAGTTGTGGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023007.1-1718s21c1
Sequence:CCGGTCTGGTGGCTCCTCTTAATAGCTCGAGCTATTAAGAGGAGCCACCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_023007.1-722s21c1
Sequence:CCGGCCTTCAGCTGGTCTGTCAATGCTCGAGCATTGACAGACCAGCTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_023007.1-647s21c1
Sequence:CCGGATGTGGATGACTACCGCTTTGCTCGAGCAAAGCGGTAGTCATCCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138765    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023007.1-2010s1c1
Sequence:CCGGGAATCCCATCTGCTGCTGAATCTCGAGATTCAGCAGCAGATGGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023007.1-405s1c1
Sequence:CCGGCGTGGTTGTACCAGTTGCAAACTCGAGTTTGCAACTGGTACAACCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_023007.1-462s1c1
Sequence:CCGGGCACATGACTCTCAGAGACTACTCGAGTAGTCTCTGAGAGTCATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023007.1-738s1c1
Sequence:CCGGCAATGTCTGTGGGAGGAAGAACTCGAGTTCTTCCTCCCACAGACATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_023007.1-646s1c1
Sequence:CCGGGATGTGGATGACTACCGCTTTCTCGAGAAAGCGGTAGTCATCCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023007.1-2122s1c1
Sequence:CCGGCCTCTTCACACTGGGTATGATCTCGAGATCATACCCAGTGTGAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023007.1-2259s1c1
Sequence:CCGGCCTCTAGTGGATCCACAGTTTCTCGAGAAACTGTGGATCCACTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023007
VALIDATED
JMJD4 MISSION shRNA Lentiviral Transduction Particles
jumonji domain containing 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023007.1-394s21c1
Sequence:CCGGACCTACGGAGACGTGGTTGTACTCGAGTACAACCACGTCTCCGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_023007.1-977s21c1
Sequence:CCGGTCAACCACAACTGGGTCAATGCTCGAGCATTGACCCAGTTGTGGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023007.1-1718s21c1
Sequence:CCGGTCTGGTGGCTCCTCTTAATAGCTCGAGCTATTAAGAGGAGCCACCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_023007.1-722s21c1
Sequence:CCGGCCTTCAGCTGGTCTGTCAATGCTCGAGCATTGACAGACCAGCTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_023007.1-647s21c1
Sequence:CCGGATGTGGATGACTACCGCTTTGCTCGAGCAAAGCGGTAGTCATCCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138765    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023007.1-2010s1c1
Sequence:CCGGGAATCCCATCTGCTGCTGAATCTCGAGATTCAGCAGCAGATGGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023007.1-405s1c1
Sequence:CCGGCGTGGTTGTACCAGTTGCAAACTCGAGTTTGCAACTGGTACAACCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_023007.1-462s1c1
Sequence:CCGGGCACATGACTCTCAGAGACTACTCGAGTAGTCTCTGAGAGTCATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023007.1-738s1c1
Sequence:CCGGCAATGTCTGTGGGAGGAAGAACTCGAGTTCTTCCTCCCACAGACATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_023007.1-646s1c1
Sequence:CCGGGATGTGGATGACTACCGCTTTCTCGAGAAAGCGGTAGTCATCCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023007.1-2122s1c1
Sequence:CCGGCCTCTTCACACTGGGTATGATCTCGAGATCATACCCAGTGTGAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023007.1-2259s1c1
Sequence:CCGGCCTCTAGTGGATCCACAGTTTCTCGAGAAACTGTGGATCCACTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178659
JMJD4 MISSION shRNA Bacterial Glycerol Stock
jumonji domain containing 4
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219635    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178659.5-2165s1c1
Sequence:CCGGGGCTAGAGGCACAGTACTAAACTCGAGTTTAGTACTGTGCCTCTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178659.5-490s1c1
Sequence:CCGGCATGTCCTTCCGCGACTATATCTCGAGATATAGTCGCGGAAGGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178659.3-405s1c1
Sequence:CCGGGAGTATCTGCAGCAGAAGTATCTCGAGATACTTCTGCTGCAGATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178659.3-675s1c1
Sequence:CCGGGTCCTCAATGTGGATGACTATCTCGAGATAGTCATCCACATTGAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178659.3-457s1c1
Sequence:CCGGGAGTGCGAGAATACAATTCAACTCGAGTTGAATTGTATTCTCGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178659.3-1668s1c1
Sequence:CCGGGCCAAGAATGTGAATTGAGTACTCGAGTACTCAATTCACATTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178659.3-680s1c1
Sequence:CCGGCAATGTGGATGACTATCGTTTCTCGAGAAACGATAGTCATCCACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178659.3-2602s1c1
Sequence:CCGGGCTGAATTTGTGAACATCTTTCTCGAGAAAGATGTTCACAAATTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178659.3-3537s1c1
Sequence:CCGGGCCACAATTTGAAAGTTGTTTCTCGAGAAACAACTTTCAAATTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178659.3-840s1c1
Sequence:CCGGCATGGTAACCTGCCCTATGATCTCGAGATCATAGGGCAGGTTACCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178659.3-605s1c1
Sequence:CCGGGAATGACTTGGAAGACATATTCTCGAGAATATGTCTTCCAAGTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178659
JMJD4 MISSION shRNA shRNA Plasmid DNA
jumonji domain containing 4
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219635    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178659.5-2165s1c1
Sequence:CCGGGGCTAGAGGCACAGTACTAAACTCGAGTTTAGTACTGTGCCTCTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178659.5-490s1c1
Sequence:CCGGCATGTCCTTCCGCGACTATATCTCGAGATATAGTCGCGGAAGGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178659.3-405s1c1
Sequence:CCGGGAGTATCTGCAGCAGAAGTATCTCGAGATACTTCTGCTGCAGATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178659.3-675s1c1
Sequence:CCGGGTCCTCAATGTGGATGACTATCTCGAGATAGTCATCCACATTGAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178659.3-457s1c1
Sequence:CCGGGAGTGCGAGAATACAATTCAACTCGAGTTGAATTGTATTCTCGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178659.3-1668s1c1
Sequence:CCGGGCCAAGAATGTGAATTGAGTACTCGAGTACTCAATTCACATTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178659.3-680s1c1
Sequence:CCGGCAATGTGGATGACTATCGTTTCTCGAGAAACGATAGTCATCCACATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178659.3-2602s1c1
Sequence:CCGGGCTGAATTTGTGAACATCTTTCTCGAGAAAGATGTTCACAAATTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178659.3-3537s1c1
Sequence:CCGGGCCACAATTTGAAAGTTGTTTCTCGAGAAACAACTTTCAAATTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178659.3-840s1c1
Sequence:CCGGCATGGTAACCTGCCCTATGATCTCGAGATCATAGGGCAGGTTACCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178659.3-605s1c1
Sequence:CCGGGAATGACTTGGAAGACATATTCTCGAGAATATGTCTTCCAAGTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178659
JMJD4 MISSION shRNA Lentiviral Transduction Particles
jumonji domain containing 4
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219635    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178659.5-2165s1c1
Sequence:CCGGGGCTAGAGGCACAGTACTAAACTCGAGTTTAGTACTGTGCCTCTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178659.5-490s1c1
Sequence:CCGGCATGTCCTTCCGCGACTATATCTCGAGATATAGTCGCGGAAGGACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178659.3-405s1c1
Sequence:CCGGGAGTATCTGCAGCAGAAGTATCTCGAGATACTTCTGCTGCAGATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178659.3-675s1c1
Sequence:CCGGGTCCTCAATGTGGATGACTATCTCGAGATAGTCATCCACATTGAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178659.3-457s1c1
Sequence:CCGGGAGTGCGAGAATACAATTCAACTCGAGTTGAATTGTATTCTCGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178659.3-1668s1c1
Sequence:CCGGGCCAAGAATGTGAATTGAGTACTCGAGTACTCAATTCACATTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178659.3-680s1c1
Sequence:CCGGCAATGTGGATGACTATCGTTTCTCGAGAAACGATAGTCATCCACATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178659.3-2602s1c1
Sequence:CCGGGCTGAATTTGTGAACATCTTTCTCGAGAAAGATGTTCACAAATTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178659.3-3537s1c1
Sequence:CCGGGCCACAATTTGAAAGTTGTTTCTCGAGAAACAACTTTCAAATTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178659.3-840s1c1
Sequence:CCGGCATGGTAACCTGCCCTATGATCTCGAGATCATAGGGCAGGTTACCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178659.3-605s1c1
Sequence:CCGGGAATGACTTGGAAGACATATTCTCGAGAATATGTCTTCCAAGTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)