EMAIL THIS PAGE TO A FRIEND

JMJD6

jumonji domain containing 6

90 Gene Product Result for
Synonyms: PSR PTDSR PTDSR1
UniProtKB ID: Q6NYC1, B3KMN8, B4DGX1, Q86VY0, Q8IUM5, Q9Y4E2
Gene ID:
Human(23210) Summary: This gene encodes a nuclear protein with a JmjC domain. JmjC domain-containing proteins are predicted to function as protein hydroxylases or histone demethylases. This protein was first identified as a putative phosphatidylserine receptor involved in phagocytosis of apoptotic cells; however, subsequent studies have indicated that it does not directly function in the clearance of apoptotic cells, and questioned whether it is a true phosphatidylserine receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(107817) jumonji domain containing 6
Rat(360665) jumonji domain containing 6
Zebrafish(266962) jumonji domain containing 6
chicken(417355) jumonji domain containing 6
cow(508343) jumonji domain containing 6
domestic cat(101085674) jumonji domain containing 6
dog(483335) jumonji domain containing 6
sheep(101103656) jumonji domain containing 6
domestic guinea pig(100722696) jumonji domain containing 6
naked mole-rat(101718399) jumonji domain containing 6
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015167 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033398 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033398 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033398 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081461 Rosetta Predictions human pricing
NM_015167 Rosetta Predictions human pricing
NM_001012143 Rosetta Predictions rat pricing
NM_033398 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316353 predicted 988
2 SASI_Hs02_00316354 predicted 903
3 SASI_Hs02_00316355 predicted 726
4 SASI_Hs02_00316356 predicted 516
5 SASI_Hs02_00316357 predicted 615
6 SASI_Hs02_00316358 predicted 1139
7 SASI_Hs02_00316359 predicted 1009
8 SASI_Hs02_00316360 predicted 631
9 SASI_Hs02_00316361 predicted 1018
10 SASI_Hs02_00316362 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096604 predicted 993
2 SASI_Hs01_00096605 predicted 899
3 SASI_Hs01_00096610 predicted 726
4 SASI_Hs02_00347155 predicted 516
5 SASI_Hs02_00347156 predicted 623
6 SASI_Hs01_00096611 predicted 1139
7 SASI_Hs01_00096612 predicted 1006
8 SASI_Hs01_00096613 predicted 637
9 SASI_Hs02_00347157 predicted 1016
10 SASI_Hs02_00347158 predicted 1246
11 SASI_Hs01_00096606 predicted 1134
12 SASI_Hs01_00096607 predicted 1006
13 SASI_Hs01_00096608 predicted 1133
14 SASI_Hs01_00096609 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012143 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050993 predicted 1359
2 SASI_Rn02_00200315 predicted 1181
3 SASI_Rn01_00050994 predicted 1122
4 SASI_Rn01_00050996 predicted 988
5 SASI_Rn02_00200316 predicted 1414
6 SASI_Rn01_00050998 predicted 354
7 SASI_Rn02_00200317 predicted 1162
8 SASI_Rn01_00050999 predicted 586
9 SASI_Rn02_00200318 predicted 1215
10 SASI_Rn02_00200319 predicted 886
11 SASI_Rn01_00050995 predicted 1133
12 SASI_Rn01_00050997 predicted 537
13 SASI_Rn01_00051000 predicted 354
14 SASI_Rn01_00051001 predicted 586
15 SASI_Rn01_00051002 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195183 predicted 948
2 SASI_Mm01_00195184 predicted 1334
3 SASI_Mm01_00195185 predicted 955
4 SASI_Mm01_00195186 predicted 541
5 SASI_Mm01_00195187 predicted 938
6 SASI_Mm01_00195189 predicted 401
7 SASI_Mm01_00195190 predicted 859
8 SASI_Mm01_00195191 predicted 1188
9 SASI_Mm01_00195192 predicted 635
10 SASI_Mm02_00337349 predicted 1014
11 SASI_Mm01_00195188 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015167
VALIDATED
JMJD6 MISSION shRNA Bacterial Glycerol Stock
jumonji domain containing 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015167.2-576s21c1
Sequence:CCGGATGGACTCTGGAGCGCCTAAACTCGAGTTTAGGCGCTCCAGAGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303286    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015167.2-1664s21c1
Sequence:CCGGCACGGGAACCCATTCACTTAGCTCGAGCTAAGTGAATGGGTTCCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_015167.2-507s21c1
Sequence:CCGGGCGGTATGAAAGACCTTACAACTCGAGTTGTAAGGTCTTTCATACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015167.1-1076s1c1
Sequence:CCGGCAGAGAGGATTAGGGACACTTCTCGAGAAGTGTCCCTAATCCTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015167.1-315s1c1
Sequence:CCGGCGATGGCTACTCAGTGAAGATCTCGAGATCTTCACTGAGTAGCCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015167.1-690s1c1
Sequence:CCGGCGAAGCTATTACCTGGTTTAACTCGAGTTAAACCAGGTAATAGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015167.1-183s1c1
Sequence:CCGGGCGGTATGAAAGACCTTACAACTCGAGTTGTAAGGTCTTTCATACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015167.1-84s1c1
Sequence:CCGGGCACAACTACTACGAGAGCTTCTCGAGAAGCTCTCGTAGTAGTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015167.2-639s21c1
Sequence:CCGGCGATGGCTACTCAGTGAAGATCTCGAGATCTTCACTGAGTAGCCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_015167.2-408s21c1
Sequence:CCGGGCACAACTACTACGAGAGCTTCTCGAGAAGCTCTCGTAGTAGTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015167
VALIDATED
JMJD6 MISSION shRNA shRNA Plasmid DNA
jumonji domain containing 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015167.2-576s21c1
Sequence:CCGGATGGACTCTGGAGCGCCTAAACTCGAGTTTAGGCGCTCCAGAGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303286    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015167.2-1664s21c1
Sequence:CCGGCACGGGAACCCATTCACTTAGCTCGAGCTAAGTGAATGGGTTCCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_015167.2-507s21c1
Sequence:CCGGGCGGTATGAAAGACCTTACAACTCGAGTTGTAAGGTCTTTCATACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015167.1-1076s1c1
Sequence:CCGGCAGAGAGGATTAGGGACACTTCTCGAGAAGTGTCCCTAATCCTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015167.1-315s1c1
Sequence:CCGGCGATGGCTACTCAGTGAAGATCTCGAGATCTTCACTGAGTAGCCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015167.1-690s1c1
Sequence:CCGGCGAAGCTATTACCTGGTTTAACTCGAGTTAAACCAGGTAATAGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015167.1-183s1c1
Sequence:CCGGGCGGTATGAAAGACCTTACAACTCGAGTTGTAAGGTCTTTCATACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015167.1-84s1c1
Sequence:CCGGGCACAACTACTACGAGAGCTTCTCGAGAAGCTCTCGTAGTAGTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015167.2-639s21c1
Sequence:CCGGCGATGGCTACTCAGTGAAGATCTCGAGATCTTCACTGAGTAGCCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_015167.2-408s21c1
Sequence:CCGGGCACAACTACTACGAGAGCTTCTCGAGAAGCTCTCGTAGTAGTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015167
VALIDATED
JMJD6 MISSION shRNA Lentiviral Transduction Particles
jumonji domain containing 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015167.2-576s21c1
Sequence:CCGGATGGACTCTGGAGCGCCTAAACTCGAGTTTAGGCGCTCCAGAGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303286    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015167.2-1664s21c1
Sequence:CCGGCACGGGAACCCATTCACTTAGCTCGAGCTAAGTGAATGGGTTCCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_015167.2-507s21c1
Sequence:CCGGGCGGTATGAAAGACCTTACAACTCGAGTTGTAAGGTCTTTCATACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015167.1-1076s1c1
Sequence:CCGGCAGAGAGGATTAGGGACACTTCTCGAGAAGTGTCCCTAATCCTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015167.1-315s1c1
Sequence:CCGGCGATGGCTACTCAGTGAAGATCTCGAGATCTTCACTGAGTAGCCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015167.1-690s1c1
Sequence:CCGGCGAAGCTATTACCTGGTTTAACTCGAGTTAAACCAGGTAATAGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015167.1-183s1c1
Sequence:CCGGGCGGTATGAAAGACCTTACAACTCGAGTTGTAAGGTCTTTCATACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015167.1-84s1c1
Sequence:CCGGGCACAACTACTACGAGAGCTTCTCGAGAAGCTCTCGTAGTAGTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015167.2-639s21c1
Sequence:CCGGCGATGGCTACTCAGTGAAGATCTCGAGATCTTCACTGAGTAGCCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_015167.2-408s21c1
Sequence:CCGGGCACAACTACTACGAGAGCTTCTCGAGAAGCTCTCGTAGTAGTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033398
VALIDATED
JMJD6 MISSION shRNA Bacterial Glycerol Stock
jumonji domain containing 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033398.1-575s1c1
Sequence:CCGGCCCTTTACATCTTCGATAGCACTCGAGTGCTATCGAAGATGTAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033398.2-598s1c1
Sequence:CCGGGAAGTACTACATCGAGTACATCTCGAGATGTACTCGATGTAGTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033398.2-408s21c1
Sequence:CCGGCCTTACAGCTGTCGGTGAAAGCTCGAGCTTTCACCGACAGCTGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033398.2-1479s21c1
Sequence:CCGGCCGCTGTCTGTGCCAGGATATCTCGAGATATCCTGGCACAGACAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033398.2-1177s21c1
Sequence:CCGGGTTATCAAGGAAGTGGTATAGCTCGAGCTATACCACTTCCTTGATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033398.2-551s21c1
Sequence:CCGGTTCAAGTGCGGCGAGGATAATCTCGAGATTATCCTCGCCGCACTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033398.2-946s21c1
Sequence:CCGGTGAAGCAATTACCTGGTTTAACTCGAGTTAAACCAGGTAATTGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033398
VALIDATED
JMJD6 MISSION shRNA shRNA Plasmid DNA
jumonji domain containing 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033398.1-575s1c1
Sequence:CCGGCCCTTTACATCTTCGATAGCACTCGAGTGCTATCGAAGATGTAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033398.2-598s1c1
Sequence:CCGGGAAGTACTACATCGAGTACATCTCGAGATGTACTCGATGTAGTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033398.2-408s21c1
Sequence:CCGGCCTTACAGCTGTCGGTGAAAGCTCGAGCTTTCACCGACAGCTGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033398.2-1479s21c1
Sequence:CCGGCCGCTGTCTGTGCCAGGATATCTCGAGATATCCTGGCACAGACAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033398.2-1177s21c1
Sequence:CCGGGTTATCAAGGAAGTGGTATAGCTCGAGCTATACCACTTCCTTGATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033398.2-551s21c1
Sequence:CCGGTTCAAGTGCGGCGAGGATAATCTCGAGATTATCCTCGCCGCACTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033398.2-946s21c1
Sequence:CCGGTGAAGCAATTACCTGGTTTAACTCGAGTTAAACCAGGTAATTGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033398
VALIDATED
JMJD6 MISSION shRNA Lentiviral Transduction Particles
jumonji domain containing 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033398.1-575s1c1
Sequence:CCGGCCCTTTACATCTTCGATAGCACTCGAGTGCTATCGAAGATGTAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033398.2-598s1c1
Sequence:CCGGGAAGTACTACATCGAGTACATCTCGAGATGTACTCGATGTAGTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033398.2-408s21c1
Sequence:CCGGCCTTACAGCTGTCGGTGAAAGCTCGAGCTTTCACCGACAGCTGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033398.2-1479s21c1
Sequence:CCGGCCGCTGTCTGTGCCAGGATATCTCGAGATATCCTGGCACAGACAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033398.2-1177s21c1
Sequence:CCGGGTTATCAAGGAAGTGGTATAGCTCGAGCTATACCACTTCCTTGATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033398.2-551s21c1
Sequence:CCGGTTCAAGTGCGGCGAGGATAATCTCGAGATTATCCTCGCCGCACTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033398.2-946s21c1
Sequence:CCGGTGAAGCAATTACCTGGTTTAACTCGAGTTAAACCAGGTAATTGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)