EMAIL THIS PAGE TO A FRIEND

JMJD7

jumonji domain containing 7

42 Gene Product Result for
UniProtKB ID: P0C870, A5D6V5, O95712, Q59GF9, Q8TB10, Q9UKV7
Gene ID:
Human(100137047) Summary: This gene encodes a highly conserved protein with a JmjC domain, which are part of the cupin metalloenzyme superfamily. JmjC proteins may function as 2-oxoglutarate-Fe(II)-dependent dioxygenases. Most tissues also express read-through transcripts from this gene into the downstream phospholipase A2, group IVB (cytosolic) gene, some of which may encode fusion proteins combining the N-terminus of this protein with the phospholipase A2, group IVB protein. [provided by RefSeq, Jul 2008]
Mouse(433466) jumonji domain containing 7
Rat(100137086) jumonji domain containing 7
domestic guinea pig(100721451) jumonji domain containing 7
sheep(101116914) jumonji domain containing 7
Domestic Rabbit(100341549) jumonji domain containing 7
Zebrafish(550278) jumonji domain containing 7
cow(100137087) jumonji domain containing 7
Horse(100533115) jumonji domain containing 7
dog(100533116) jumonji domain containing 7
chicken(423221) jumonji domain containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001114632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001114632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001114632 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057041 MISSION® esiRNA esiRNA human AC020743.7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114632 Rosetta Predictions human pricing
NM_001114656 Rosetta Predictions rat pricing
NM_001114637 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326704 predicted 515
2 SASI_Hs02_00326705 predicted 465
3 SASI_Hs02_00326706 predicted 503
4 SASI_Hs02_00326707 predicted 511
5 SASI_Hs02_00326708 predicted 214
6 SASI_Hs02_00326709 predicted 215
7 SASI_Hs02_00326710 predicted 490
8 SASI_Hs02_00326711 predicted 400
9 SASI_Hs02_00326712 predicted 495
10 SASI_Hs02_00326713 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252353 predicted 674
2 SASI_Rn02_00252354 predicted 243
3 SASI_Rn02_00252355 predicted 576
4 SASI_Rn02_00252356 predicted 249
5 SASI_Rn02_00252357 predicted 545
6 SASI_Rn02_00252358 predicted 435
7 SASI_Rn02_00252359 predicted 1067
8 SASI_Rn02_00252360 predicted 865
9 SASI_Rn02_00252361 predicted 520
10 SASI_Rn02_00252362 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114637 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308747 predicted 274
2 SASI_Mm02_00308748 predicted 264
3 SASI_Mm02_00308749 predicted 667
4 SASI_Mm02_00308750 predicted 358
5 SASI_Mm02_00308751 predicted 565
6 SASI_Mm02_00308752 predicted 456
7 SASI_Mm02_00308753 predicted 886
8 SASI_Mm02_00308754 predicted 1093
9 SASI_Mm02_00308755 predicted 1034
10 SASI_Mm02_00308756 predicted 1156
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001114632
VALIDATED
JMJD7 MISSION shRNA Bacterial Glycerol Stock
jumonji domain containing 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114632.1-926s21c1
Sequence:CCGGTACGACCTCAAGTATAGTTACCTCGAGGTAACTATACTTGAGGTCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001114632.1-833s21c1
Sequence:CCGGGCCGGTGAGATGCTCTATCTGCTCGAGCAGATAGAGCATCTCACCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114632.1-889s21c1
Sequence:CCGGGGGCTGCATCGCAGTGAATTTCTCGAGAAATTCACTGCGATGCAGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001114632.1-1134s21c1
Sequence:CCGGGATCTTGGAATGTGGTCATAACTCGAGTTATGACCACATTCCAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114632.1-986s21c1
Sequence:CCGGGACTGATGGAGCACTGGTGAACTCGAGTTCACCAGTGCTCCATCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001114632
VALIDATED
JMJD7 MISSION shRNA shRNA Plasmid DNA
jumonji domain containing 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114632.1-926s21c1
Sequence:CCGGTACGACCTCAAGTATAGTTACCTCGAGGTAACTATACTTGAGGTCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001114632.1-833s21c1
Sequence:CCGGGCCGGTGAGATGCTCTATCTGCTCGAGCAGATAGAGCATCTCACCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114632.1-889s21c1
Sequence:CCGGGGGCTGCATCGCAGTGAATTTCTCGAGAAATTCACTGCGATGCAGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001114632.1-1134s21c1
Sequence:CCGGGATCTTGGAATGTGGTCATAACTCGAGTTATGACCACATTCCAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114632.1-986s21c1
Sequence:CCGGGACTGATGGAGCACTGGTGAACTCGAGTTCACCAGTGCTCCATCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001114632
VALIDATED
JMJD7 MISSION shRNA Lentiviral Transduction Particles
jumonji domain containing 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114632.1-926s21c1
Sequence:CCGGTACGACCTCAAGTATAGTTACCTCGAGGTAACTATACTTGAGGTCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001114632.1-833s21c1
Sequence:CCGGGCCGGTGAGATGCTCTATCTGCTCGAGCAGATAGAGCATCTCACCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114632.1-889s21c1
Sequence:CCGGGGGCTGCATCGCAGTGAATTTCTCGAGAAATTCACTGCGATGCAGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001114632.1-1134s21c1
Sequence:CCGGGATCTTGGAATGTGGTCATAACTCGAGTTATGACCACATTCCAAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114632.1-986s21c1
Sequence:CCGGGACTGATGGAGCACTGGTGAACTCGAGTTCACCAGTGCTCCATCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)