EMAIL THIS PAGE TO A FRIEND

JMJD8

jumonji domain containing 8

51 Gene Product Result for
Synonyms: C16orf20
Gene ID:
Mouse(72106) jumonji domain containing 8
Rat(360498) jumonji domain containing 8
chicken(426917) jumonji domain containing 8
domestic cat(101092574) jumonji domain containing 8
dog(490091) jumonji domain containing 8
cow(100139040) jumonji domain containing 8
domestic guinea pig(100721018) jumonji domain containing 8
naked mole-rat(101702567) jumonji domain containing 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500271 Anti-JMJD8 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2107320 Anti-JMJD8 antibody produced in rabbit affinity isolated antibody bovine, human, horse, pig, dog, rat, mouse
western blot pricing
AV31975 Anti-LOC339123 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB2101361 Anti-LOC339123 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005920 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028101 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028101 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028101 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005920 Rosetta Predictions human pricing
NM_001014116 Rosetta Predictions rat pricing
NM_028101 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305056 predicted 436
2 SASI_Hs02_00305057 predicted 819
3 SASI_Hs01_00228275 predicted 685
4 SASI_Hs01_00228276 predicted 601
5 SASI_Hs01_00228278 predicted 496
6 SASI_Hs01_00228282 predicted 650
7 SASI_Hs02_00305058 predicted 898
8 SASI_Hs02_00305059 predicted 697
9 SASI_Hs01_00228283 predicted 677
10 SASI_Hs02_00305060 predicted 604
11 SASI_Hs01_00228274 predicted 1243
12 SASI_Hs01_00228277 predicted 1102
13 SASI_Hs01_00228279 predicted 714
14 SASI_Hs01_00228280 predicted 1088
15 SASI_Hs01_00228281 predicted 1252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034018 predicted 608
2 SASI_Rn01_00034019 predicted 1356
3 SASI_Rn01_00034020 predicted 1090
4 SASI_Rn01_00034021 predicted 1018
5 SASI_Rn01_00034022 predicted 648
6 SASI_Rn01_00034023 predicted 399
7 SASI_Rn01_00034024 predicted 788
8 SASI_Rn01_00034025 predicted 627
9 SASI_Rn02_00201558 predicted 1070
10 SASI_Rn01_00034026 predicted 622
11 SASI_Rn01_00034027 predicted 1528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028101 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101726 predicted 1138
2 SASI_Mm01_00101727 predicted 630
3 SASI_Mm01_00101728 predicted 741
4 SASI_Mm01_00101729 predicted 248
5 SASI_Mm01_00101730 predicted 417
6 SASI_Mm01_00101732 predicted 1253
7 SASI_Mm01_00101733 predicted 648
8 SASI_Mm01_00101734 predicted 880
9 SASI_Mm01_00101735 predicted 218
10 SASI_Mm02_00333345 predicted 708
11 SASI_Mm01_00101731 predicted 885
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005920
VALIDATED
JMJD8 MISSION shRNA Bacterial Glycerol Stock
jumonji domain containing 8
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005920.2-371s21c1
Sequence:CCGGACAGGTTGCTGGCTTCGTTTGCTCGAGCAAACGAAGCCAGCAACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005920.2-420s1c1
Sequence:CCGGCAACACCTACTCCTACCACAACTCGAGTTGTGGTAGGAGTAGGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005920.2-446s21c1
Sequence:CCGGACTTGCCCTTCCAGGAGTATGCTCGAGCATACTCCTGGAAGGGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005920.2-1246s1c1
Sequence:CCGGCAGAGATGAATGCGTCAATAACTCGAGTTATTGACGCATTCATCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005920.2-1137s1c1
Sequence:CCGGCCAGGAACATAAACTATGTATCTCGAGATACATAGTTTATGTTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005920.2-507s1c1
Sequence:CCGGCAATGACACCCTGTACTTCTTCTCGAGAAGAAGTACAGGGTGTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005920.2-423s1c1
Sequence:CCGGCACCTACTCCTACCACAAAGTCTCGAGACTTTGTGGTAGGAGTAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005920.2-605s1c1
Sequence:CCGGCTCCAGCTTACAGCTTTGGAACTCGAGTTCCAAAGCTGTAAGCTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005920.2-705s1c1
Sequence:CCGGGTTCCTTTACCCACCTGAGAACTCGAGTTCTCAGGTGGGTAAAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005920.2-677s1c1
Sequence:CCGGCAGAAGTGATCTACGGTCGTACTCGAGTACGACCGTAGATCACTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005920.2-422s21c1
Sequence:CCGGACACCTACTCCTACCACAAAGCTCGAGCTTTGTGGTAGGAGTAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005920.2-693s21c1
Sequence:CCGGTCGTAAGCGCTGGTTCCTTTACTCGAGTAAAGGAACCAGCGCTTACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005920
VALIDATED
JMJD8 MISSION shRNA shRNA Plasmid DNA
jumonji domain containing 8
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005920.2-371s21c1
Sequence:CCGGACAGGTTGCTGGCTTCGTTTGCTCGAGCAAACGAAGCCAGCAACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005920.2-420s1c1
Sequence:CCGGCAACACCTACTCCTACCACAACTCGAGTTGTGGTAGGAGTAGGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005920.2-446s21c1
Sequence:CCGGACTTGCCCTTCCAGGAGTATGCTCGAGCATACTCCTGGAAGGGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005920.2-1246s1c1
Sequence:CCGGCAGAGATGAATGCGTCAATAACTCGAGTTATTGACGCATTCATCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005920.2-1137s1c1
Sequence:CCGGCCAGGAACATAAACTATGTATCTCGAGATACATAGTTTATGTTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005920.2-507s1c1
Sequence:CCGGCAATGACACCCTGTACTTCTTCTCGAGAAGAAGTACAGGGTGTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005920.2-423s1c1
Sequence:CCGGCACCTACTCCTACCACAAAGTCTCGAGACTTTGTGGTAGGAGTAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005920.2-605s1c1
Sequence:CCGGCTCCAGCTTACAGCTTTGGAACTCGAGTTCCAAAGCTGTAAGCTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005920.2-705s1c1
Sequence:CCGGGTTCCTTTACCCACCTGAGAACTCGAGTTCTCAGGTGGGTAAAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005920.2-677s1c1
Sequence:CCGGCAGAAGTGATCTACGGTCGTACTCGAGTACGACCGTAGATCACTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005920.2-422s21c1
Sequence:CCGGACACCTACTCCTACCACAAAGCTCGAGCTTTGTGGTAGGAGTAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005920.2-693s21c1
Sequence:CCGGTCGTAAGCGCTGGTTCCTTTACTCGAGTAAAGGAACCAGCGCTTACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005920
VALIDATED
JMJD8 MISSION shRNA Lentiviral Transduction Particles
jumonji domain containing 8
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005920.2-371s21c1
Sequence:CCGGACAGGTTGCTGGCTTCGTTTGCTCGAGCAAACGAAGCCAGCAACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005920.2-420s1c1
Sequence:CCGGCAACACCTACTCCTACCACAACTCGAGTTGTGGTAGGAGTAGGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005920.2-446s21c1
Sequence:CCGGACTTGCCCTTCCAGGAGTATGCTCGAGCATACTCCTGGAAGGGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005920.2-1246s1c1
Sequence:CCGGCAGAGATGAATGCGTCAATAACTCGAGTTATTGACGCATTCATCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005920.2-1137s1c1
Sequence:CCGGCCAGGAACATAAACTATGTATCTCGAGATACATAGTTTATGTTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005920.2-507s1c1
Sequence:CCGGCAATGACACCCTGTACTTCTTCTCGAGAAGAAGTACAGGGTGTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005920.2-423s1c1
Sequence:CCGGCACCTACTCCTACCACAAAGTCTCGAGACTTTGTGGTAGGAGTAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005920.2-605s1c1
Sequence:CCGGCTCCAGCTTACAGCTTTGGAACTCGAGTTCCAAAGCTGTAAGCTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005920.2-705s1c1
Sequence:CCGGGTTCCTTTACCCACCTGAGAACTCGAGTTCTCAGGTGGGTAAAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005920.2-677s1c1
Sequence:CCGGCAGAAGTGATCTACGGTCGTACTCGAGTACGACCGTAGATCACTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005920.2-422s21c1
Sequence:CCGGACACCTACTCCTACCACAAAGCTCGAGCTTTGTGGTAGGAGTAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005920.2-693s21c1
Sequence:CCGGTCGTAAGCGCTGGTTCCTTTACTCGAGTAAAGGAACCAGCGCTTACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028101
VALIDATED
JMJD8 MISSION shRNA Bacterial Glycerol Stock
jumonji domain containing 8
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028101.3-659s21c1
Sequence:CCGGCACCCTAACAAGACCACATTGCTCGAGCAATGTGGTCTTGTTAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028101.1-59s1c1
Sequence:CCGGGCTCTTTGTACTATGGATGATCTCGAGATCATCCATAGTACAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028101.3-1448s21c1
Sequence:CCGGCAGGGATATCTCGCTTCTATACTCGAGTATAGAAGCGAGATATCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028101.1-659s1c1
Sequence:CCGGCCACCCTAACAAGACCACATTCTCGAGAATGTGGTCTTGTTAGGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028101.1-1411s1c1
Sequence:CCGGCCGCATCAGCTCAAAGCTAATCTCGAGATTAGCTTTGAGCTGATGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028101.3-365s21c1
Sequence:CCGGGACCTGCCCTTCCAGGAATATCTCGAGATATTCCTGGAAGGGCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028101.3-133s21c1
Sequence:CCGGGGGAATTGCAGCAGCAGTAATCTCGAGATTACTGCTGCTGCAATTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028101
VALIDATED
JMJD8 MISSION shRNA shRNA Plasmid DNA
jumonji domain containing 8
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028101.3-659s21c1
Sequence:CCGGCACCCTAACAAGACCACATTGCTCGAGCAATGTGGTCTTGTTAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028101.1-59s1c1
Sequence:CCGGGCTCTTTGTACTATGGATGATCTCGAGATCATCCATAGTACAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028101.3-1448s21c1
Sequence:CCGGCAGGGATATCTCGCTTCTATACTCGAGTATAGAAGCGAGATATCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028101.1-659s1c1
Sequence:CCGGCCACCCTAACAAGACCACATTCTCGAGAATGTGGTCTTGTTAGGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028101.1-1411s1c1
Sequence:CCGGCCGCATCAGCTCAAAGCTAATCTCGAGATTAGCTTTGAGCTGATGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028101.3-365s21c1
Sequence:CCGGGACCTGCCCTTCCAGGAATATCTCGAGATATTCCTGGAAGGGCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028101.3-133s21c1
Sequence:CCGGGGGAATTGCAGCAGCAGTAATCTCGAGATTACTGCTGCTGCAATTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028101
VALIDATED
JMJD8 MISSION shRNA Lentiviral Transduction Particles
jumonji domain containing 8
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028101.3-659s21c1
Sequence:CCGGCACCCTAACAAGACCACATTGCTCGAGCAATGTGGTCTTGTTAGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028101.1-59s1c1
Sequence:CCGGGCTCTTTGTACTATGGATGATCTCGAGATCATCCATAGTACAAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028101.3-1448s21c1
Sequence:CCGGCAGGGATATCTCGCTTCTATACTCGAGTATAGAAGCGAGATATCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028101.1-659s1c1
Sequence:CCGGCCACCCTAACAAGACCACATTCTCGAGAATGTGGTCTTGTTAGGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028101.1-1411s1c1
Sequence:CCGGCCGCATCAGCTCAAAGCTAATCTCGAGATTAGCTTTGAGCTGATGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028101.3-365s21c1
Sequence:CCGGGACCTGCCCTTCCAGGAATATCTCGAGATATTCCTGGAAGGGCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028101.3-133s21c1
Sequence:CCGGGGGAATTGCAGCAGCAGTAATCTCGAGATTACTGCTGCTGCAATTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)