EMAIL THIS PAGE TO A FRIEND

JMY

junction mediating and regulatory protein, p53 cofactor

39 Gene Product Result for
Synonyms: WHDC1L3
UniProtKB ID: Q8N9B5, A1L4P5, B5MDS2, B5MDT0
Gene ID:
Mouse(57748) junction-mediating and regulatory protein
Zebrafish(406556) junction mediating and regulatory protein, p53 cofactor
cow(528498) junction mediating and regulatory protein, p53 cofactor
domestic cat(101089418) junction mediating and regulatory protein, p53 cofactor
dog(610323) junction mediating and regulatory protein, p53 cofactor
chicken(427182) junction mediating and regulatory protein, p53 cofactor
domestic guinea pig(100725446) junction mediating and regulatory protein, p53 cofactor
naked mole-rat(101702759) junction mediating and regulatory protein, p53 cofactor
sheep(101108836) junction mediating and regulatory protein, p53 cofactor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021310 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021310 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021310 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152405 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152405 Rosetta Predictions human pricing
NM_021310 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366091 predicted 1244
2 SASI_Hs01_00081989 predicted 751
3 SASI_Hs01_00081990 predicted 1348
4 SASI_Hs01_00081991 predicted 347
5 SASI_Hs01_00081992 predicted 2058
6 SASI_Hs01_00081994 predicted 658
7 SASI_Hs01_00081995 predicted 1278
8 SASI_Hs02_00366092 predicted 1264
9 SASI_Hs02_00366093 predicted 2025
10 SASI_Hs01_00081998 predicted 415
11 SASI_Hs01_00081993 predicted 2225
12 SASI_Hs01_00081996 predicted 2182
13 SASI_Hs01_00081997 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043711 predicted 1792
2 SASI_Mm01_00043712 predicted 3397
3 SASI_Mm01_00043713 predicted 2428
4 SASI_Mm01_00043714 predicted 2287
5 SASI_Mm01_00043715 predicted 2389
6 SASI_Mm01_00043716 predicted 3056
7 SASI_Mm01_00043717 predicted 1211
8 SASI_Mm01_00043718 predicted 3197
9 SASI_Mm01_00043719 predicted 2393
10 SASI_Mm01_00043720 predicted 2448
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021310
JMY MISSION shRNA Bacterial Glycerol Stock
junction mediating and regulatory protein, p53 cofactor
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021310.2-2302s21c1
Sequence:CCGGGAGCCCATCATACAATACAAACTCGAGTTTGTATTGTATGATGGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021310.2-3428s21c1
Sequence:CCGGGATTCCATTATGTCCTGAGTACTCGAGTACTCAGGACATAATGGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021310.2-2025s21c1
Sequence:CCGGGAGAGCATCAAGAGACTTATACTCGAGTATAAGTCTCTTGATGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021310.2-3251s21c1
Sequence:CCGGCGAAGCTCTAAGAAGAATCAACTCGAGTTGATTCTTCTTAGAGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021310.1-2045s1c1
Sequence:CCGGGAGCCCATCATACAATACAAACTCGAGTTTGTATTGTATGATGGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021310.1-2994s1c1
Sequence:CCGGCGAAGCTCTAAGAAGAATCAACTCGAGTTGATTCTTCTTAGAGCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021310.1-3171s1c1
Sequence:CCGGGATTCCATTATGTCCTGAGTACTCGAGTACTCAGGACATAATGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021310.1-1768s1c1
Sequence:CCGGGAGAGCATCAAGAGACTTATACTCGAGTATAAGTCTCTTGATGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021310
JMY MISSION shRNA shRNA Plasmid DNA
junction mediating and regulatory protein, p53 cofactor
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021310.2-2302s21c1
Sequence:CCGGGAGCCCATCATACAATACAAACTCGAGTTTGTATTGTATGATGGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021310.2-3428s21c1
Sequence:CCGGGATTCCATTATGTCCTGAGTACTCGAGTACTCAGGACATAATGGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021310.2-2025s21c1
Sequence:CCGGGAGAGCATCAAGAGACTTATACTCGAGTATAAGTCTCTTGATGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021310.2-3251s21c1
Sequence:CCGGCGAAGCTCTAAGAAGAATCAACTCGAGTTGATTCTTCTTAGAGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021310.1-2045s1c1
Sequence:CCGGGAGCCCATCATACAATACAAACTCGAGTTTGTATTGTATGATGGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021310.1-2994s1c1
Sequence:CCGGCGAAGCTCTAAGAAGAATCAACTCGAGTTGATTCTTCTTAGAGCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021310.1-3171s1c1
Sequence:CCGGGATTCCATTATGTCCTGAGTACTCGAGTACTCAGGACATAATGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021310.1-1768s1c1
Sequence:CCGGGAGAGCATCAAGAGACTTATACTCGAGTATAAGTCTCTTGATGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021310
JMY MISSION shRNA Lentiviral Transduction Particles
junction mediating and regulatory protein, p53 cofactor
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021310.2-2302s21c1
Sequence:CCGGGAGCCCATCATACAATACAAACTCGAGTTTGTATTGTATGATGGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021310.2-3428s21c1
Sequence:CCGGGATTCCATTATGTCCTGAGTACTCGAGTACTCAGGACATAATGGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021310.2-2025s21c1
Sequence:CCGGGAGAGCATCAAGAGACTTATACTCGAGTATAAGTCTCTTGATGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021310.2-3251s21c1
Sequence:CCGGCGAAGCTCTAAGAAGAATCAACTCGAGTTGATTCTTCTTAGAGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021310.1-2045s1c1
Sequence:CCGGGAGCCCATCATACAATACAAACTCGAGTTTGTATTGTATGATGGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021310.1-2994s1c1
Sequence:CCGGCGAAGCTCTAAGAAGAATCAACTCGAGTTGATTCTTCTTAGAGCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021310.1-3171s1c1
Sequence:CCGGGATTCCATTATGTCCTGAGTACTCGAGTACTCAGGACATAATGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021310.1-1768s1c1
Sequence:CCGGGAGAGCATCAAGAGACTTATACTCGAGTATAAGTCTCTTGATGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152405
VALIDATED
JMY MISSION shRNA Bacterial Glycerol Stock
junction mediating and regulatory protein, p53 cofactor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152405.1-1330s1c1
Sequence:CCGGGAACCATGTTCTGTTACCATACTCGAGTATGGTAACAGAACATGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152405.1-430s1c1
Sequence:CCGGGCTAAAGAGATATGCTTGGAACTCGAGTTCCAAGCATATCTCTTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152405.1-325s1c1
Sequence:CCGGCGAGCTGATCAGAAGAAATTTCTCGAGAAATTTCTTCTGATCAGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_152405.1-872s1c1
Sequence:CCGGGCACTCGGATTGAAGATGAATCTCGAGATTCATCTTCAATCCGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_152405.1-1787s1c1
Sequence:CCGGCCTTCACACTTCTACCCGATACTCGAGTATCGGGTAGAAGTGTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152405.1-2026s1c1
Sequence:CCGGGCATTGGTTCAGTGGTGTGAACTCGAGTTCACACCACTGAACCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152405.1-2233s1c1
Sequence:CCGGGCTTGCTGTAAGTTGGAAGAACTCGAGTTCTTCCAACTTACAGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152405.1-1822s1c1
Sequence:CCGGCGGAGCATCCATGAAGCTCTTCTCGAGAAGAGCTTCATGGATGCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152405.1-532s1c1
Sequence:CCGGGCTGATTATTATGACCTGCAACTCGAGTTGCAGGTCATAATAATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152405
VALIDATED
JMY MISSION shRNA shRNA Plasmid DNA
junction mediating and regulatory protein, p53 cofactor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152405.1-1330s1c1
Sequence:CCGGGAACCATGTTCTGTTACCATACTCGAGTATGGTAACAGAACATGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152405.1-430s1c1
Sequence:CCGGGCTAAAGAGATATGCTTGGAACTCGAGTTCCAAGCATATCTCTTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152405.1-325s1c1
Sequence:CCGGCGAGCTGATCAGAAGAAATTTCTCGAGAAATTTCTTCTGATCAGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_152405.1-872s1c1
Sequence:CCGGGCACTCGGATTGAAGATGAATCTCGAGATTCATCTTCAATCCGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_152405.1-1787s1c1
Sequence:CCGGCCTTCACACTTCTACCCGATACTCGAGTATCGGGTAGAAGTGTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152405.1-2026s1c1
Sequence:CCGGGCATTGGTTCAGTGGTGTGAACTCGAGTTCACACCACTGAACCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152405.1-2233s1c1
Sequence:CCGGGCTTGCTGTAAGTTGGAAGAACTCGAGTTCTTCCAACTTACAGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152405.1-1822s1c1
Sequence:CCGGCGGAGCATCCATGAAGCTCTTCTCGAGAAGAGCTTCATGGATGCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152405.1-532s1c1
Sequence:CCGGGCTGATTATTATGACCTGCAACTCGAGTTGCAGGTCATAATAATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152405
VALIDATED
JMY MISSION shRNA Lentiviral Transduction Particles
junction mediating and regulatory protein, p53 cofactor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152405.1-1330s1c1
Sequence:CCGGGAACCATGTTCTGTTACCATACTCGAGTATGGTAACAGAACATGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152405.1-430s1c1
Sequence:CCGGGCTAAAGAGATATGCTTGGAACTCGAGTTCCAAGCATATCTCTTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152405.1-325s1c1
Sequence:CCGGCGAGCTGATCAGAAGAAATTTCTCGAGAAATTTCTTCTGATCAGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_152405.1-872s1c1
Sequence:CCGGGCACTCGGATTGAAGATGAATCTCGAGATTCATCTTCAATCCGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_152405.1-1787s1c1
Sequence:CCGGCCTTCACACTTCTACCCGATACTCGAGTATCGGGTAGAAGTGTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152405.1-2026s1c1
Sequence:CCGGGCATTGGTTCAGTGGTGTGAACTCGAGTTCACACCACTGAACCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152405.1-2233s1c1
Sequence:CCGGGCTTGCTGTAAGTTGGAAGAACTCGAGTTCTTCCAACTTACAGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152405.1-1822s1c1
Sequence:CCGGCGGAGCATCCATGAAGCTCTTCTCGAGAAGAGCTTCATGGATGCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152405.1-532s1c1
Sequence:CCGGGCTGATTATTATGACCTGCAACTCGAGTTGCAGGTCATAATAATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)