EMAIL THIS PAGE TO A FRIEND

JOSD1

Josephin domain containing 1

192 Gene Product Result for
Synonyms: dJ508I15.2
UniProtKB ID: Q15040, A8K712
Gene ID:
Mouse(74158) Josephin domain containing 1
Rat(315134) Josephin domain containing 1
Zebrafish(767655) Josephin domain containing 1
chicken(418023) Josephin domain containing 1
cow(510781) Josephin domain containing 1
domestic cat(101081646) Josephin domain containing 1
dog(481251) Josephin domain containing 1
sheep(101105900) Josephin domain containing 1
domestic guinea pig(100729641) Josephin domain containing 1
naked mole-rat(101704183) Josephin domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014876 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028792 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028792 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028792 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014876 Rosetta Predictions human pricing
NM_001025009 Rosetta Predictions rat pricing
NM_028792 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346483 predicted 453
2 SASI_Hs01_00072064 predicted 563
3 SASI_Hs01_00072065 predicted 1048
4 SASI_Hs01_00072066 predicted 449
5 SASI_Hs02_00346484 predicted 364
6 SASI_Hs01_00072067 predicted 617
7 SASI_Hs01_00072068 predicted 1045
8 SASI_Hs01_00072069 predicted 1101
9 SASI_Hs01_00072070 predicted 538
10 SASI_Hs02_00346485 predicted 1015
11 SASI_Hs01_00072063 predicted 873
12 SASI_Hs01_00072071 predicted 773
13 SASI_Hs01_00072072 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045140 predicted 582
2 SASI_Rn01_00045141 predicted 1100
3 SASI_Rn01_00045142 predicted 517
4 SASI_Rn01_00045143 predicted 435
5 SASI_Rn01_00045144 predicted 697
6 SASI_Rn01_00045145 predicted 673
7 SASI_Rn01_00045146 predicted 669
8 SASI_Rn01_00045147 predicted 981
9 SASI_Rn01_00045148 predicted 845
10 SASI_Rn01_00045149 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097227 predicted 1061
2 SASI_Mm01_00097229 predicted 1560
3 SASI_Mm01_00097232 predicted 1658
4 SASI_Mm02_00334400 predicted 1017
5 SASI_Mm01_00097225 predicted 1217
6 SASI_Mm01_00097226 predicted 1343
7 SASI_Mm01_00097228 predicted 1418
8 SASI_Mm01_00097230 predicted 1874
9 SASI_Mm01_00097231 predicted 1837
10 SASI_Mm02_00334401 predicted 1817
11 SASI_Mm01_00097233 predicted 1798
12 SASI_Mm01_00097234 predicted 1145
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014876
VALIDATED
JOSD1 MISSION shRNA Bacterial Glycerol Stock
Josephin domain containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014876.5-996s21c1
Sequence:CCGGTTGCGAGGAAAGAACTGTGAACTCGAGTTCACAGTTCTTTCCTCGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014876.3-544s1c1
Sequence:CCGGCTACGATGTGAATGTCATTATCTCGAGATAATGACATTCACATCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_014876.3-757s1c1
Sequence:CCGGCCTCGACTCCAAACTCAAGATCTCGAGATCTTGAGTTTGGAGTCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014876.3-370s1c1
Sequence:CCGGCCCACAAATCTACCATGAGAACTCGAGTTCTCATGGTAGATTTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014876.3-579s1c1
Sequence:CCGGCCAAAGGCTATGAAGCTGTTTCTCGAGAAACAGCTTCATAGCCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014876.3-569s1c1
Sequence:CCGGGCACTTCAGACCAAAGGCTATCTCGAGATAGCCTTTGGTCTGAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014876.5-1519s21c1
Sequence:CCGGTTGAAGGACCCAGAGCATAAACTCGAGTTTATGCTCTGGGTCCTTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014876.5-1218s21c1
Sequence:CCGGAGACGTGTGGACTGTTATAAGCTCGAGCTTATAACAGTCCACACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014876.5-789s21c1
Sequence:CCGGGGTGTCATTGCCCTCACTAACCTCGAGGTTAGTGAGGGCAATGACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014876.5-968s21c1
Sequence:CCGGCGAGCTCAGGAAGTTTCTAAACTCGAGTTTAGAAACTTCCTGAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014876.5-583s21c1
Sequence:CCGGACGCCCTCAATAACGTCTTCCCTCGAGGGAAGACGTTATTGAGGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014876
VALIDATED
JOSD1 MISSION shRNA shRNA Plasmid DNA
Josephin domain containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014876.5-996s21c1
Sequence:CCGGTTGCGAGGAAAGAACTGTGAACTCGAGTTCACAGTTCTTTCCTCGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014876.3-544s1c1
Sequence:CCGGCTACGATGTGAATGTCATTATCTCGAGATAATGACATTCACATCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_014876.3-757s1c1
Sequence:CCGGCCTCGACTCCAAACTCAAGATCTCGAGATCTTGAGTTTGGAGTCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014876.3-370s1c1
Sequence:CCGGCCCACAAATCTACCATGAGAACTCGAGTTCTCATGGTAGATTTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014876.3-579s1c1
Sequence:CCGGCCAAAGGCTATGAAGCTGTTTCTCGAGAAACAGCTTCATAGCCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014876.3-569s1c1
Sequence:CCGGGCACTTCAGACCAAAGGCTATCTCGAGATAGCCTTTGGTCTGAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014876.5-1519s21c1
Sequence:CCGGTTGAAGGACCCAGAGCATAAACTCGAGTTTATGCTCTGGGTCCTTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014876.5-1218s21c1
Sequence:CCGGAGACGTGTGGACTGTTATAAGCTCGAGCTTATAACAGTCCACACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014876.5-789s21c1
Sequence:CCGGGGTGTCATTGCCCTCACTAACCTCGAGGTTAGTGAGGGCAATGACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014876.5-968s21c1
Sequence:CCGGCGAGCTCAGGAAGTTTCTAAACTCGAGTTTAGAAACTTCCTGAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014876.5-583s21c1
Sequence:CCGGACGCCCTCAATAACGTCTTCCCTCGAGGGAAGACGTTATTGAGGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014876
VALIDATED
JOSD1 MISSION shRNA Lentiviral Transduction Particles
Josephin domain containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014876.5-996s21c1
Sequence:CCGGTTGCGAGGAAAGAACTGTGAACTCGAGTTCACAGTTCTTTCCTCGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014876.3-544s1c1
Sequence:CCGGCTACGATGTGAATGTCATTATCTCGAGATAATGACATTCACATCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_014876.3-757s1c1
Sequence:CCGGCCTCGACTCCAAACTCAAGATCTCGAGATCTTGAGTTTGGAGTCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014876.3-370s1c1
Sequence:CCGGCCCACAAATCTACCATGAGAACTCGAGTTCTCATGGTAGATTTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014876.3-579s1c1
Sequence:CCGGCCAAAGGCTATGAAGCTGTTTCTCGAGAAACAGCTTCATAGCCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014876.3-569s1c1
Sequence:CCGGGCACTTCAGACCAAAGGCTATCTCGAGATAGCCTTTGGTCTGAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014876.5-1519s21c1
Sequence:CCGGTTGAAGGACCCAGAGCATAAACTCGAGTTTATGCTCTGGGTCCTTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014876.5-1218s21c1
Sequence:CCGGAGACGTGTGGACTGTTATAAGCTCGAGCTTATAACAGTCCACACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014876.5-789s21c1
Sequence:CCGGGGTGTCATTGCCCTCACTAACCTCGAGGTTAGTGAGGGCAATGACACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014876.5-968s21c1
Sequence:CCGGCGAGCTCAGGAAGTTTCTAAACTCGAGTTTAGAAACTTCCTGAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014876.5-583s21c1
Sequence:CCGGACGCCCTCAATAACGTCTTCCCTCGAGGGAAGACGTTATTGAGGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028792
VALIDATED
JOSD1 MISSION shRNA Bacterial Glycerol Stock
Josephin domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028792.1-1360s1c1
Sequence:CCGGCCTTGACTCCAAACTCAAGATCTCGAGATCTTGAGTTTGGAGTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028792.3-2184s21c1
Sequence:CCGGCTAATCGTGTCCCTATCATTTCTCGAGAAATGATAGGGACACGATTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028792.3-2116s21c1
Sequence:CCGGTGGTGAAAGATATGCCTAATACTCGAGTATTAGGCATATCTTTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028792.1-1182s1c1
Sequence:CCGGCCAAAGGCTATGAAGCTGTTTCTCGAGAAACAGCTTCATAGCCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028792.3-2184s1c1
Sequence:CCGGCTAATCGTGTCCCTATCATTTCTCGAGAAATGATAGGGACACGATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028792.3-2084s21c1
Sequence:CCGGTAGGTGAATTGCACATCATTCCTCGAGGAATGATGTGCAATTCACCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028792.3-3133s21c1
Sequence:CCGGGGGATGTACAAAGACGCTTAACTCGAGTTAAGCGTCTTTGTACATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028792.3-3008s21c1
Sequence:CCGGCATTGGCACTGTCGGTGATAGCTCGAGCTATCACCGACAGTGCCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028792
VALIDATED
JOSD1 MISSION shRNA shRNA Plasmid DNA
Josephin domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028792.1-1360s1c1
Sequence:CCGGCCTTGACTCCAAACTCAAGATCTCGAGATCTTGAGTTTGGAGTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028792.3-2184s21c1
Sequence:CCGGCTAATCGTGTCCCTATCATTTCTCGAGAAATGATAGGGACACGATTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028792.3-2116s21c1
Sequence:CCGGTGGTGAAAGATATGCCTAATACTCGAGTATTAGGCATATCTTTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028792.1-1182s1c1
Sequence:CCGGCCAAAGGCTATGAAGCTGTTTCTCGAGAAACAGCTTCATAGCCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028792.3-2184s1c1
Sequence:CCGGCTAATCGTGTCCCTATCATTTCTCGAGAAATGATAGGGACACGATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028792.3-2084s21c1
Sequence:CCGGTAGGTGAATTGCACATCATTCCTCGAGGAATGATGTGCAATTCACCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028792.3-3133s21c1
Sequence:CCGGGGGATGTACAAAGACGCTTAACTCGAGTTAAGCGTCTTTGTACATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028792.3-3008s21c1
Sequence:CCGGCATTGGCACTGTCGGTGATAGCTCGAGCTATCACCGACAGTGCCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028792
VALIDATED
JOSD1 MISSION shRNA Lentiviral Transduction Particles
Josephin domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028792.1-1360s1c1
Sequence:CCGGCCTTGACTCCAAACTCAAGATCTCGAGATCTTGAGTTTGGAGTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028792.3-2184s21c1
Sequence:CCGGCTAATCGTGTCCCTATCATTTCTCGAGAAATGATAGGGACACGATTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028792.3-2116s21c1
Sequence:CCGGTGGTGAAAGATATGCCTAATACTCGAGTATTAGGCATATCTTTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028792.1-1182s1c1
Sequence:CCGGCCAAAGGCTATGAAGCTGTTTCTCGAGAAACAGCTTCATAGCCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028792.3-2184s1c1
Sequence:CCGGCTAATCGTGTCCCTATCATTTCTCGAGAAATGATAGGGACACGATTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028792.3-2084s21c1
Sequence:CCGGTAGGTGAATTGCACATCATTCCTCGAGGAATGATGTGCAATTCACCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028792.3-3133s21c1
Sequence:CCGGGGGATGTACAAAGACGCTTAACTCGAGTTAAGCGTCTTTGTACATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028792.3-3008s21c1
Sequence:CCGGCATTGGCACTGTCGGTGATAGCTCGAGCTATCACCGACAGTGCCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)