EMAIL THIS PAGE TO A FRIEND

JOSD2

Josephin domain containing 2

45 Gene Product Result for
UniProtKB ID: Q8TAC2, M0QX25
Gene ID:
Human(126119) Summary: This gene encodes a protein containing a Josephin domain. Josephin domain-containing proteins are deubiquitinating enzymes which catalyze the hydrolysis of the bond between the C-terminal glycine of the ubiquitin peptide and protein substrates. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(66124) Josephin domain containing 2
Rat(292876) Josephin domain containing 2
domestic guinea pig(100718654) Josephin domain containing 2
sheep(101110355) Josephin domain containing 2
Zebrafish(393120) Josephin domain containing 2
domestic cat(101085935) Josephin domain containing 2
dog(611845) Josephin domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025368 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025368 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025368 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138334 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138334 Rosetta Predictions human pricing
NM_001106256 Rosetta Predictions rat pricing
NM_025368 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128488 predicted 420
2 SASI_Hs01_00128489 predicted 221
3 SASI_Hs01_00128491 predicted 224
4 SASI_Hs01_00128492 predicted 420
5 SASI_Hs01_00128493 predicted 268
6 SASI_Hs01_00128494 predicted 209
7 SASI_Hs01_00128495 predicted 222
8 SASI_Hs01_00128496 predicted 529
9 SASI_Hs01_00128497 predicted 531
10 SASI_Hs02_00363424 predicted 220
11 SASI_Hs01_00128490 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106256 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217178 predicted 431
2 SASI_Rn02_00217179 predicted 312
3 SASI_Rn02_00217180 predicted 253
4 SASI_Rn02_00217181 predicted 533
5 SASI_Rn02_00217182 predicted 252
6 SASI_Rn02_00217183 predicted 553
7 SASI_Rn02_00217184 predicted 426
8 SASI_Rn02_00217185 predicted 434
9 SASI_Rn02_00217186 predicted 333
10 SASI_Rn02_00217187 predicted 201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025368 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197270 predicted 443
2 SASI_Mm01_00197271 predicted 539
3 SASI_Mm01_00197272 predicted 323
4 SASI_Mm01_00197273 predicted 533
5 SASI_Mm01_00197274 predicted 340
6 SASI_Mm01_00197276 predicted 553
7 SASI_Mm01_00197277 predicted 211
8 SASI_Mm02_00328083 predicted 218
9 SASI_Mm01_00197279 predicted 391
10 SASI_Mm02_00328084 predicted 446
11 SASI_Mm01_00197275 predicted 257
12 SASI_Mm01_00197278 predicted 350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025368
VALIDATED
JOSD2 MISSION shRNA Bacterial Glycerol Stock
Josephin domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025368.3-346s21c1
Sequence:CCGGGCAACTATGATGTCAACGTGACTCGAGTCACGTTGACATCATAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025368.3-447s21c1
Sequence:CCGGCAGGTACTAGGCCTGATCTTGCTCGAGCAAGATCAGGCCTAGTACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025368.1-347s1c1
Sequence:CCGGGCAACTATGATGTCAACGTGACTCGAGTCACGTTGACATCATAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025368.1-244s1c1
Sequence:CCGGGTCCTTCAAGAGCAGCTCTTTCTCGAGAAAGAGCTGCTCTTGAAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025368.1-551s1c1
Sequence:CCGGGCATCTACTATAATCTGGACTCTCGAGAGTCCAGATTATAGTAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025368.3-540s21c1
Sequence:CCGGCAGGTAGATGGCATCTACTATCTCGAGATAGTAGATGCCATCTACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025368.3-243s21c1
Sequence:CCGGGTCCTTCAAGAGCAGCTCTTTCTCGAGAAAGAGCTGCTCTTGAAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025368.3-177s21c1
Sequence:CCGGAGTCCACCCTCAGTGTATCATCTCGAGATGATACACTGAGGGTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025368.1-541s1c1
Sequence:CCGGCAGGTAGATGGCATCTACTATCTCGAGATAGTAGATGCCATCTACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025368
VALIDATED
JOSD2 MISSION shRNA shRNA Plasmid DNA
Josephin domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025368.3-346s21c1
Sequence:CCGGGCAACTATGATGTCAACGTGACTCGAGTCACGTTGACATCATAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025368.3-447s21c1
Sequence:CCGGCAGGTACTAGGCCTGATCTTGCTCGAGCAAGATCAGGCCTAGTACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025368.1-347s1c1
Sequence:CCGGGCAACTATGATGTCAACGTGACTCGAGTCACGTTGACATCATAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025368.1-244s1c1
Sequence:CCGGGTCCTTCAAGAGCAGCTCTTTCTCGAGAAAGAGCTGCTCTTGAAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025368.1-551s1c1
Sequence:CCGGGCATCTACTATAATCTGGACTCTCGAGAGTCCAGATTATAGTAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025368.3-540s21c1
Sequence:CCGGCAGGTAGATGGCATCTACTATCTCGAGATAGTAGATGCCATCTACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025368.3-243s21c1
Sequence:CCGGGTCCTTCAAGAGCAGCTCTTTCTCGAGAAAGAGCTGCTCTTGAAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025368.3-177s21c1
Sequence:CCGGAGTCCACCCTCAGTGTATCATCTCGAGATGATACACTGAGGGTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025368.1-541s1c1
Sequence:CCGGCAGGTAGATGGCATCTACTATCTCGAGATAGTAGATGCCATCTACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025368
VALIDATED
JOSD2 MISSION shRNA Lentiviral Transduction Particles
Josephin domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025368.3-346s21c1
Sequence:CCGGGCAACTATGATGTCAACGTGACTCGAGTCACGTTGACATCATAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025368.3-447s21c1
Sequence:CCGGCAGGTACTAGGCCTGATCTTGCTCGAGCAAGATCAGGCCTAGTACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025368.1-347s1c1
Sequence:CCGGGCAACTATGATGTCAACGTGACTCGAGTCACGTTGACATCATAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025368.1-244s1c1
Sequence:CCGGGTCCTTCAAGAGCAGCTCTTTCTCGAGAAAGAGCTGCTCTTGAAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025368.1-551s1c1
Sequence:CCGGGCATCTACTATAATCTGGACTCTCGAGAGTCCAGATTATAGTAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025368.3-540s21c1
Sequence:CCGGCAGGTAGATGGCATCTACTATCTCGAGATAGTAGATGCCATCTACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025368.3-243s21c1
Sequence:CCGGGTCCTTCAAGAGCAGCTCTTTCTCGAGAAAGAGCTGCTCTTGAAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025368.3-177s21c1
Sequence:CCGGAGTCCACCCTCAGTGTATCATCTCGAGATGATACACTGAGGGTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025368.1-541s1c1
Sequence:CCGGCAGGTAGATGGCATCTACTATCTCGAGATAGTAGATGCCATCTACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138334
JOSD2 MISSION shRNA Bacterial Glycerol Stock
Josephin domain containing 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-228s1c1
Sequence:CCGGGCAACTATGATGTCAATGTGACTCGAGTCACATTGACATCATAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-160s1c1
Sequence:CCGGCGATGAGATCTGCAAGAGGTTCTCGAGAACCTCTTGCAGATCTCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-432s1c1
Sequence:CCGGGTGTCTACTACAACCTGGACTCTCGAGAGTCCAGGTTGTAGTAGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-223s1c1
Sequence:CCGGCACCGGCAACTATGATGTCAACTCGAGTTGACATCATAGTTGCCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-436s1c1
Sequence:CCGGCTACTACAACCTGGACTCCAACTCGAGTTGGAGTCCAGGTTGTAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-421s1c1
Sequence:CCGGCCAGGTGGACGGTGTCTACTACTCGAGTAGTAGACACCGTCCACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-229s1c1
Sequence:CCGGCAACTATGATGTCAATGTGATCTCGAGATCACATTGACATCATAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138334
JOSD2 MISSION shRNA shRNA Plasmid DNA
Josephin domain containing 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-228s1c1
Sequence:CCGGGCAACTATGATGTCAATGTGACTCGAGTCACATTGACATCATAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-160s1c1
Sequence:CCGGCGATGAGATCTGCAAGAGGTTCTCGAGAACCTCTTGCAGATCTCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-432s1c1
Sequence:CCGGGTGTCTACTACAACCTGGACTCTCGAGAGTCCAGGTTGTAGTAGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-223s1c1
Sequence:CCGGCACCGGCAACTATGATGTCAACTCGAGTTGACATCATAGTTGCCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-436s1c1
Sequence:CCGGCTACTACAACCTGGACTCCAACTCGAGTTGGAGTCCAGGTTGTAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-421s1c1
Sequence:CCGGCCAGGTGGACGGTGTCTACTACTCGAGTAGTAGACACCGTCCACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-229s1c1
Sequence:CCGGCAACTATGATGTCAATGTGATCTCGAGATCACATTGACATCATAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138334
JOSD2 MISSION shRNA Lentiviral Transduction Particles
Josephin domain containing 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-228s1c1
Sequence:CCGGGCAACTATGATGTCAATGTGACTCGAGTCACATTGACATCATAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-160s1c1
Sequence:CCGGCGATGAGATCTGCAAGAGGTTCTCGAGAACCTCTTGCAGATCTCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-432s1c1
Sequence:CCGGGTGTCTACTACAACCTGGACTCTCGAGAGTCCAGGTTGTAGTAGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-223s1c1
Sequence:CCGGCACCGGCAACTATGATGTCAACTCGAGTTGACATCATAGTTGCCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-436s1c1
Sequence:CCGGCTACTACAACCTGGACTCCAACTCGAGTTGGAGTCCAGGTTGTAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-421s1c1
Sequence:CCGGCCAGGTGGACGGTGTCTACTACTCGAGTAGTAGACACCGTCCACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138334.1-229s1c1
Sequence:CCGGCAACTATGATGTCAATGTGATCTCGAGATCACATTGACATCATAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)