EMAIL THIS PAGE TO A FRIEND

JPH2

junctophilin 2

212 Gene Product Result for
Synonyms: CMH17 JP-2 JP2
UniProtKB ID: Q9BR39, E1P5X1, O95913, Q5JY74, Q9UJN4
Gene ID:
Human(57158) Summary: Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. This gene is a member of the junctophilin gene family. Alternative splicing has been observed at this locus and two variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2008]
Mouse(59091) junctophilin 2
Rat(296345) junctophilin 2
Zebrafish(553333) junctophilin 2
dog(610874) junctophilin 2
domestic cat(101091186) junctophilin 2
cow(614651) junctophilin 2
Horse(100055888) junctophilin 2
chicken(770867) junctophilin 2
sheep(101105592) junctophilin 2
naked mole-rat(101714099) junctophilin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021566 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021566 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021566 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020433 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020433 Rosetta Predictions human pricing
NM_175913 Rosetta Predictions human pricing
NM_001037974 Rosetta Predictions rat pricing
NM_021566 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044904 predicted 884
2 SASI_Hs01_00044905 predicted 1005
3 SASI_Hs01_00044907 predicted 980
4 SASI_Hs01_00044908 predicted 984
5 SASI_Hs01_00044909 predicted 998
6 SASI_Hs01_00044910 predicted 986
7 SASI_Hs01_00044911 predicted 974
8 SASI_Hs02_00353453 predicted 974
9 SASI_Hs02_00353454 predicted 984
10 SASI_Hs02_00353455 predicted 975
11 SASI_Hs01_00044906 predicted 934
12 SASI_Hs01_00044912 predicted 997
13 SASI_Hs01_00044913 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078800 predicted 878
2 SASI_Hs01_00078801 predicted 1004
3 SASI_Hs01_00078803 predicted 984
4 SASI_Hs01_00078804 predicted 991
5 SASI_Hs01_00078805 predicted 1003
6 SASI_Hs01_00078806 predicted 986
7 SASI_Hs01_00078807 predicted 980
8 SASI_Hs02_00369171 predicted 972
9 SASI_Hs02_00369172 predicted 981
10 SASI_Hs02_00369173 predicted 979
11 SASI_Hs01_00078802 predicted 937
12 SASI_Hs01_00078808 predicted 999
13 SASI_Hs01_00078809 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049616 predicted 1246
2 SASI_Rn01_00049617 predicted 208
3 SASI_Rn02_00204651 predicted 746
4 SASI_Rn02_00204652 predicted 205
5 SASI_Rn01_00049619 predicted 236
6 SASI_Rn01_00049620 predicted 1693
7 SASI_Rn01_00049621 predicted 318
8 SASI_Rn01_00049623 predicted 935
9 SASI_Rn02_00204653 predicted 1701
10 SASI_Rn01_00049625 predicted 412
11 SASI_Rn01_00049618 predicted 1238
12 SASI_Rn01_00049622 predicted 1147
13 SASI_Rn01_00049624 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193310 predicted 588
2 SASI_Mm01_00193311 predicted 1620
3 SASI_Mm01_00193312 predicted 621
4 SASI_Mm01_00193313 predicted 706
5 SASI_Mm01_00193314 predicted 2376
6 SASI_Mm01_00193315 predicted 1636
7 SASI_Mm01_00193316 predicted 549
8 SASI_Mm01_00193317 predicted 799
9 SASI_Mm01_00193318 predicted 668
10 SASI_Mm02_00326355 predicted 1328
11 SASI_Mm01_00193319 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021566
JPH2 MISSION shRNA Bacterial Glycerol Stock
junctophilin 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021566.1-708s21c1
Sequence:CCGGGAATCCGGCAGAGCACAAACACTCGAGTGTTTGTGCTCTGCCGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021566.1-1640s21c1
Sequence:CCGGTCCAACATCGCCCGTACATTGCTCGAGCAATGTACGGGCGATGTTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021566.1-592s1c1
Sequence:CCGGTGGGAATACCTTTGAGGGATACTCGAGTATCCCTCAAAGGTATTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021566.1-2531s1c1
Sequence:CCGGGCCAGGAGTTCCACTGAGGATCTCGAGATCCTCAGTGGAACTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021566.1-1429s1c1
Sequence:CCGGCCGCCACAATGTGCTGGTCAACTCGAGTTGACCAGCACATTGTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021566.1-802s1c1
Sequence:CCGGAGGAACCTATCAAGGCCAATTCTCGAGAATTGGCCTTGATAGGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021566.1-2446s1c1
Sequence:CCGGCGTCCTCATCTGTATGGTGATCTCGAGATCACCATACAGATGAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021566
JPH2 MISSION shRNA shRNA Plasmid DNA
junctophilin 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021566.1-708s21c1
Sequence:CCGGGAATCCGGCAGAGCACAAACACTCGAGTGTTTGTGCTCTGCCGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021566.1-1640s21c1
Sequence:CCGGTCCAACATCGCCCGTACATTGCTCGAGCAATGTACGGGCGATGTTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021566.1-592s1c1
Sequence:CCGGTGGGAATACCTTTGAGGGATACTCGAGTATCCCTCAAAGGTATTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021566.1-2531s1c1
Sequence:CCGGGCCAGGAGTTCCACTGAGGATCTCGAGATCCTCAGTGGAACTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021566.1-1429s1c1
Sequence:CCGGCCGCCACAATGTGCTGGTCAACTCGAGTTGACCAGCACATTGTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021566.1-802s1c1
Sequence:CCGGAGGAACCTATCAAGGCCAATTCTCGAGAATTGGCCTTGATAGGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021566.1-2446s1c1
Sequence:CCGGCGTCCTCATCTGTATGGTGATCTCGAGATCACCATACAGATGAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021566
JPH2 MISSION shRNA Lentiviral Transduction Particles
junctophilin 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021566.1-708s21c1
Sequence:CCGGGAATCCGGCAGAGCACAAACACTCGAGTGTTTGTGCTCTGCCGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021566.1-1640s21c1
Sequence:CCGGTCCAACATCGCCCGTACATTGCTCGAGCAATGTACGGGCGATGTTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021566.1-592s1c1
Sequence:CCGGTGGGAATACCTTTGAGGGATACTCGAGTATCCCTCAAAGGTATTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021566.1-2531s1c1
Sequence:CCGGGCCAGGAGTTCCACTGAGGATCTCGAGATCCTCAGTGGAACTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021566.1-1429s1c1
Sequence:CCGGCCGCCACAATGTGCTGGTCAACTCGAGTTGACCAGCACATTGTGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021566.1-802s1c1
Sequence:CCGGAGGAACCTATCAAGGCCAATTCTCGAGAATTGGCCTTGATAGGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021566.1-2446s1c1
Sequence:CCGGCGTCCTCATCTGTATGGTGATCTCGAGATCACCATACAGATGAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020433
JPH2 MISSION shRNA Bacterial Glycerol Stock
junctophilin 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020433.3-4274s1c1
Sequence:CCGGCCCTTCATTTCTGTGGACCTTCTCGAGAAGGTCCACAGAAATGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020433.4-4409s1c1
Sequence:CCGGGCTTCACACTTGCCGTTTCAACTCGAGTTGAAACGGCAAGTGTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020433.3-1043s1c1
Sequence:CCGGGAAACACCTTTGAGGGATACTCTCGAGAGTATCCCTCAAAGGTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020433.3-3965s1c1
Sequence:CCGGGCTGCTTGTCAAGAAGCATTTCTCGAGAAATGCTTCTTGACAAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020433.3-2889s1c1
Sequence:CCGGCAACACCATCCTCATCTGCATCTCGAGATGCAGATGAGGATGGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020433.3-2106s1c1
Sequence:CCGGGTCCAACATTGCTCGCACTTTCTCGAGAAAGTGCGAGCAATGTTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020433.3-2895s1c1
Sequence:CCGGCATCCTCATCTGCATGGTGATCTCGAGATCACCATGCAGATGAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020433.3-1041s1c1
Sequence:CCGGCGGAAACACCTTTGAGGGATACTCGAGTATCCCTCAAAGGTGTTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020433.3-2907s1c1
Sequence:CCGGCATGGTGATCCTGCTGAACATCTCGAGATGTTCAGCAGGATCACCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020433.3-4049s1c1
Sequence:CCGGCCTTTGGCTTACTTGGTAGAACTCGAGTTCTACCAAGTAAGCCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020433.3-4367s1c1
Sequence:CCGGGCTTTCCCATTTCCCTTCAATCTCGAGATTGAAGGGAAATGGGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020433
JPH2 MISSION shRNA shRNA Plasmid DNA
junctophilin 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020433.3-4274s1c1
Sequence:CCGGCCCTTCATTTCTGTGGACCTTCTCGAGAAGGTCCACAGAAATGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020433.4-4409s1c1
Sequence:CCGGGCTTCACACTTGCCGTTTCAACTCGAGTTGAAACGGCAAGTGTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020433.3-1043s1c1
Sequence:CCGGGAAACACCTTTGAGGGATACTCTCGAGAGTATCCCTCAAAGGTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020433.3-3965s1c1
Sequence:CCGGGCTGCTTGTCAAGAAGCATTTCTCGAGAAATGCTTCTTGACAAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020433.3-2889s1c1
Sequence:CCGGCAACACCATCCTCATCTGCATCTCGAGATGCAGATGAGGATGGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020433.3-2106s1c1
Sequence:CCGGGTCCAACATTGCTCGCACTTTCTCGAGAAAGTGCGAGCAATGTTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020433.3-2895s1c1
Sequence:CCGGCATCCTCATCTGCATGGTGATCTCGAGATCACCATGCAGATGAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020433.3-1041s1c1
Sequence:CCGGCGGAAACACCTTTGAGGGATACTCGAGTATCCCTCAAAGGTGTTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020433.3-2907s1c1
Sequence:CCGGCATGGTGATCCTGCTGAACATCTCGAGATGTTCAGCAGGATCACCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020433.3-4049s1c1
Sequence:CCGGCCTTTGGCTTACTTGGTAGAACTCGAGTTCTACCAAGTAAGCCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020433.3-4367s1c1
Sequence:CCGGGCTTTCCCATTTCCCTTCAATCTCGAGATTGAAGGGAAATGGGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020433
JPH2 MISSION shRNA Lentiviral Transduction Particles
junctophilin 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020433.3-4274s1c1
Sequence:CCGGCCCTTCATTTCTGTGGACCTTCTCGAGAAGGTCCACAGAAATGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020433.4-4409s1c1
Sequence:CCGGGCTTCACACTTGCCGTTTCAACTCGAGTTGAAACGGCAAGTGTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020433.3-1043s1c1
Sequence:CCGGGAAACACCTTTGAGGGATACTCTCGAGAGTATCCCTCAAAGGTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020433.3-3965s1c1
Sequence:CCGGGCTGCTTGTCAAGAAGCATTTCTCGAGAAATGCTTCTTGACAAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020433.3-2889s1c1
Sequence:CCGGCAACACCATCCTCATCTGCATCTCGAGATGCAGATGAGGATGGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020433.3-2106s1c1
Sequence:CCGGGTCCAACATTGCTCGCACTTTCTCGAGAAAGTGCGAGCAATGTTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020433.3-2895s1c1
Sequence:CCGGCATCCTCATCTGCATGGTGATCTCGAGATCACCATGCAGATGAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020433.3-1041s1c1
Sequence:CCGGCGGAAACACCTTTGAGGGATACTCGAGTATCCCTCAAAGGTGTTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020433.3-2907s1c1
Sequence:CCGGCATGGTGATCCTGCTGAACATCTCGAGATGTTCAGCAGGATCACCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020433.3-4049s1c1
Sequence:CCGGCCTTTGGCTTACTTGGTAGAACTCGAGTTCTACCAAGTAAGCCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020433.3-4367s1c1
Sequence:CCGGGCTTTCCCATTTCCCTTCAATCTCGAGATTGAAGGGAAATGGGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)