EMAIL THIS PAGE TO A FRIEND

JPH3

junctophilin 3

83 Gene Product Result for
Synonyms: CAGL237 HDL2 JP-3 JP3 TNRC22
UniProtKB ID: Q8WXH2, D3DUN2, Q8N471, Q9HDC3, Q9HDC4
Gene ID:
Human(57338) Summary: Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. CAG/CTG repeat expansions at the Huntington's disease (HD)-like 2 locus have been identified in this gene, which is a member of the junctophilin gene family. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2012]
Mouse(57340) junctophilin 3
Rat(307916) junctophilin 3
naked mole-rat(101709933) junctophilin 3
sheep(101105019) junctophilin 3
Zebrafish(324354) junctophilin 3
domestic cat(101090161) junctophilin 3
cow(507713) junctophilin 3
dog(489669) junctophilin 3
chicken(415830) junctophilin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020655 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020605 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020605 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020605 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060401 MISSION® esiRNA esiRNA human JPH3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020655 Rosetta Predictions human pricing
NM_001107437 Rosetta Predictions rat pricing
NM_020605 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100986 predicted 850
2 SASI_Hs01_00100987 predicted 2628
3 SASI_Hs01_00100988 predicted 2091
4 SASI_Hs01_00100989 predicted 2910
5 SASI_Hs01_00100990 predicted 2576
6 SASI_Hs01_00100991 predicted 1241
7 SASI_Hs01_00100992 predicted 2838
8 SASI_Hs01_00100993 predicted 2808
9 SASI_Hs01_00100994 predicted 2924
10 SASI_Hs02_00353638 predicted 1239
11 SASI_Hs01_00100995 predicted 1323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228815 predicted 859
2 SASI_Rn02_00228816 predicted 1190
3 SASI_Rn02_00228817 predicted 2730
4 SASI_Rn02_00228818 predicted 434
5 SASI_Rn02_00228819 predicted 1285
6 SASI_Rn02_00228820 predicted 1476
7 SASI_Rn02_00228821 predicted 1966
8 SASI_Rn02_00228822 predicted 1676
9 SASI_Rn02_00228823 predicted 766
10 SASI_Rn02_00228824 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190845 predicted 1085
2 SASI_Mm01_00190847 predicted 490
3 SASI_Mm01_00190848 predicted 1251
4 SASI_Mm01_00190849 predicted 1095
5 SASI_Mm01_00190850 predicted 731
6 SASI_Mm02_00325711 predicted 872
7 SASI_Mm01_00190852 predicted 314
8 SASI_Mm02_00325712 predicted 865
9 SASI_Mm01_00190853 predicted 1194
10 SASI_Mm01_00190854 predicted 442
11 SASI_Mm01_00190846 predicted 669
12 SASI_Mm01_00190851 predicted 1017
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020655
VALIDATED
JPH3 MISSION shRNA Bacterial Glycerol Stock
junctophilin 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020655.2-2915s21c1
Sequence:CCGGCGTCGACACGAGCTTAGAAAGCTCGAGCTTTCTAAGCTCGTGTCGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020655.2-926s1c1
Sequence:CCGGGCTGCGCAAGTCGGAGTCCAACTCGAGTTGGACTCCGACTTGCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020655.2-2611s1c1
Sequence:CCGGCCAAGTCCTCTCACAGAAGAACTCGAGTTCTTCTGTGAGAGGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020655.2-2468s1c1
Sequence:CCGGAGTCGCCATTCTGTTTATTAACTCGAGTTAATAAACAGAATGGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020655.2-2471s1c1
Sequence:CCGGCGCCATTCTGTTTATTAACTTCTCGAGAAGTTAATAAACAGAATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020655.2-2467s1c1
Sequence:CCGGGAGTCGCCATTCTGTTTATTACTCGAGTAATAAACAGAATGGCGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020655.2-2501s21c1
Sequence:CCGGATGAGATGTCGCGGTAGCAAACTCGAGTTTGCTACCGCGACATCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020655
VALIDATED
JPH3 MISSION shRNA shRNA Plasmid DNA
junctophilin 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020655.2-2915s21c1
Sequence:CCGGCGTCGACACGAGCTTAGAAAGCTCGAGCTTTCTAAGCTCGTGTCGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020655.2-926s1c1
Sequence:CCGGGCTGCGCAAGTCGGAGTCCAACTCGAGTTGGACTCCGACTTGCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020655.2-2611s1c1
Sequence:CCGGCCAAGTCCTCTCACAGAAGAACTCGAGTTCTTCTGTGAGAGGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020655.2-2468s1c1
Sequence:CCGGAGTCGCCATTCTGTTTATTAACTCGAGTTAATAAACAGAATGGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020655.2-2471s1c1
Sequence:CCGGCGCCATTCTGTTTATTAACTTCTCGAGAAGTTAATAAACAGAATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020655.2-2467s1c1
Sequence:CCGGGAGTCGCCATTCTGTTTATTACTCGAGTAATAAACAGAATGGCGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020655.2-2501s21c1
Sequence:CCGGATGAGATGTCGCGGTAGCAAACTCGAGTTTGCTACCGCGACATCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020655
VALIDATED
JPH3 MISSION shRNA Lentiviral Transduction Particles
junctophilin 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020655.2-2915s21c1
Sequence:CCGGCGTCGACACGAGCTTAGAAAGCTCGAGCTTTCTAAGCTCGTGTCGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020655.2-926s1c1
Sequence:CCGGGCTGCGCAAGTCGGAGTCCAACTCGAGTTGGACTCCGACTTGCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020655.2-2611s1c1
Sequence:CCGGCCAAGTCCTCTCACAGAAGAACTCGAGTTCTTCTGTGAGAGGACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020655.2-2468s1c1
Sequence:CCGGAGTCGCCATTCTGTTTATTAACTCGAGTTAATAAACAGAATGGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020655.2-2471s1c1
Sequence:CCGGCGCCATTCTGTTTATTAACTTCTCGAGAAGTTAATAAACAGAATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020655.2-2467s1c1
Sequence:CCGGGAGTCGCCATTCTGTTTATTACTCGAGTAATAAACAGAATGGCGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020655.2-2501s21c1
Sequence:CCGGATGAGATGTCGCGGTAGCAAACTCGAGTTTGCTACCGCGACATCTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020605
JPH3 MISSION shRNA Bacterial Glycerol Stock
junctophilin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020605.1-1371s1c1
Sequence:CCGGCCAGATGTCCTGCGATGATATCTCGAGATATCATCGCAGGACATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020605.1-226s1c1
Sequence:CCGGCCAAGCGGCAACACGTACCAACTCGAGTTGGTACGTGTTGCCGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020605.1-1188s1c1
Sequence:CCGGCGCCAAGCAGAAAGCCGAGATCTCGAGATCTCGGCTTTCTGCTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020605.1-2400s1c1
Sequence:CCGGCCACAGAAGAACAACATGATTCTCGAGAATCATGTTGTTCTTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020605.1-1884s1c1
Sequence:CCGGGAGCAACTACAAGCTGGAGATCTCGAGATCTCCAGCTTGTAGTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020605
JPH3 MISSION shRNA shRNA Plasmid DNA
junctophilin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020605.1-1371s1c1
Sequence:CCGGCCAGATGTCCTGCGATGATATCTCGAGATATCATCGCAGGACATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020605.1-226s1c1
Sequence:CCGGCCAAGCGGCAACACGTACCAACTCGAGTTGGTACGTGTTGCCGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020605.1-1188s1c1
Sequence:CCGGCGCCAAGCAGAAAGCCGAGATCTCGAGATCTCGGCTTTCTGCTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020605.1-2400s1c1
Sequence:CCGGCCACAGAAGAACAACATGATTCTCGAGAATCATGTTGTTCTTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020605.1-1884s1c1
Sequence:CCGGGAGCAACTACAAGCTGGAGATCTCGAGATCTCCAGCTTGTAGTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020605
JPH3 MISSION shRNA Lentiviral Transduction Particles
junctophilin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020605.1-1371s1c1
Sequence:CCGGCCAGATGTCCTGCGATGATATCTCGAGATATCATCGCAGGACATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020605.1-226s1c1
Sequence:CCGGCCAAGCGGCAACACGTACCAACTCGAGTTGGTACGTGTTGCCGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020605.1-1188s1c1
Sequence:CCGGCGCCAAGCAGAAAGCCGAGATCTCGAGATCTCGGCTTTCTGCTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020605.1-2400s1c1
Sequence:CCGGCCACAGAAGAACAACATGATTCTCGAGAATCATGTTGTTCTTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020605.1-1884s1c1
Sequence:CCGGGAGCAACTACAAGCTGGAGATCTCGAGATCTCCAGCTTGTAGTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)