EMAIL THIS PAGE TO A FRIEND

JPH4

junctophilin 4

178 Gene Product Result for
Synonyms: JP4 JPHL1
UniProtKB ID: Q96JJ6, D3DS53, Q8ND44, Q96DQ0
Gene ID:
Human(84502) Summary: This gene encodes a member of the junctophilin family of transmembrane proteins that are involved in the formation of the junctional membrane complexes between the plasma membrane and the endoplasmic/sarcoplasmic reticulum in excitable cells. The encoded protein contains a conserved N-terminal repeat region called the membrane occupation and recognition nexus sequence that is found in other members of the junctophilin family. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Mouse(319984) junctophilin 4
Rat(445271) junctophilin 4
dog(490615) junctophilin 4
cow(781073) junctophilin 4
domestic cat(101096486) junctophilin 4
sheep(101121939) junctophilin 4
naked mole-rat(101709116) junctophilin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032452 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001003829 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003829 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003829 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU043011 MISSION® esiRNA esiRNA targeting mouse Jph4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032452 Rosetta Predictions human pricing
NM_001003711 Rosetta Predictions rat pricing
XM_224184 Rosetta Predictions rat pricing
NM_001003829 Rosetta Predictions mouse pricing
NM_177049 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023986 predicted 3071
2 SASI_Hs01_00023987 predicted 3080
3 SASI_Hs01_00023988 predicted 2789
4 SASI_Hs01_00023989 predicted 3069
5 SASI_Hs01_00023990 predicted 1798
6 SASI_Hs01_00023991 predicted 2444
7 SASI_Hs01_00023992 predicted 2415
8 SASI_Hs01_00023993 predicted 3089
9 SASI_Hs02_00359879 predicted 1526
10 SASI_Hs01_00023994 predicted 1039
11 SASI_Hs01_00023995 predicted 2986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003711 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084670 predicted 1241
2 SASI_Rn02_00198061 predicted 1522
3 SASI_Rn01_00084671 predicted 733
4 SASI_Rn01_00084672 predicted 1234
5 SASI_Rn01_00084673 predicted 648
6 SASI_Rn01_00084674 predicted 896
7 SASI_Rn01_00084676 predicted 1357
8 SASI_Rn01_00084677 predicted 362
9 SASI_Rn01_00084678 predicted 746
10 SASI_Rn01_00084679 predicted 887
11 SASI_Rn01_00084675 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172515 predicted 739
2 SASI_Rn01_00172516 predicted 653
3 SASI_Rn01_00172517 predicted 626
4 SASI_Rn01_00172518 predicted 376
5 SASI_Rn01_00172519 predicted 754
6 SASI_Rn01_00172520 predicted 363
7 SASI_Rn01_00172521 predicted 1520
8 SASI_Rn01_00172522 predicted 382
9 SASI_Rn01_00172523 predicted 451
10 SASI_Rn01_00172524 predicted 1483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079204 predicted 799
2 SASI_Mm01_00079205 predicted 519
3 SASI_Mm01_00079206 predicted 769
4 SASI_Mm01_00079207 predicted 908
5 SASI_Mm01_00079208 predicted 1052
6 SASI_Mm01_00079209 predicted 1035
7 SASI_Mm01_00079210 predicted 979
8 SASI_Mm01_00079211 predicted 597
9 SASI_Mm01_00079212 predicted 385
10 SASI_Mm01_00079213 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177049 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087147 predicted 1104
2 SASI_Mm01_00087148 predicted 824
3 SASI_Mm01_00087149 predicted 1072
4 SASI_Mm01_00087150 predicted 1203
5 SASI_Mm01_00087151 predicted 1346
6 SASI_Mm01_00087152 predicted 1328
7 SASI_Mm01_00087153 predicted 1269
8 SASI_Mm01_00087154 predicted 900
9 SASI_Mm01_00087155 predicted 679
10 SASI_Mm01_00087156 predicted 1337
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032452
JPH4 MISSION shRNA Bacterial Glycerol Stock
junctophilin 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032452.2-2442s21c1
Sequence:CCGGACTAGCTGGCTATGAGGCTGACTCGAGTCAGCCTCATAGCCAGCTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032452.2-2969s21c1
Sequence:CCGCCCTGTCTTCTTTCAGATTATCCTCGAGGATAATCTGAAAGAAGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032452.2-2253s21c1
Sequence:CCGGGGTATATGAGAACGGACTGACCTCGAGGTCAGTCCGTTCTCATATACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032452.1-2118s1c1
Sequence:CCGGAGCTCGAATGGCCAAACTGATCTCGAGATCAGTTTGGCCATTCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032452.1-1041s1c1
Sequence:CCGGCTTCGAGTCACTGGGCGTCTTCTCGAGAAGACGCCCAGTGACTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032452.1-2514s1c1
Sequence:CCGGCAGTTCAGGAAGTCTTCGAGACTCGAGTCTCGAAGACTTCCTGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032452.1-2745s1c1
Sequence:CCGGCCTGGACCTCAGCCTGGCATTCTCGAGAATGCCAGGCTGAGGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032452.1-1551s1c1
Sequence:CCGGCGGATTCTTTCGCCGTTCGCTCTCGAGAGCGAACGGCGAAAGAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032452
JPH4 MISSION shRNA shRNA Plasmid DNA
junctophilin 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032452.2-2442s21c1
Sequence:CCGGACTAGCTGGCTATGAGGCTGACTCGAGTCAGCCTCATAGCCAGCTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032452.2-2969s21c1
Sequence:CCGCCCTGTCTTCTTTCAGATTATCCTCGAGGATAATCTGAAAGAAGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032452.2-2253s21c1
Sequence:CCGGGGTATATGAGAACGGACTGACCTCGAGGTCAGTCCGTTCTCATATACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032452.1-2118s1c1
Sequence:CCGGAGCTCGAATGGCCAAACTGATCTCGAGATCAGTTTGGCCATTCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032452.1-1041s1c1
Sequence:CCGGCTTCGAGTCACTGGGCGTCTTCTCGAGAAGACGCCCAGTGACTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032452.1-2514s1c1
Sequence:CCGGCAGTTCAGGAAGTCTTCGAGACTCGAGTCTCGAAGACTTCCTGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032452.1-2745s1c1
Sequence:CCGGCCTGGACCTCAGCCTGGCATTCTCGAGAATGCCAGGCTGAGGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032452.1-1551s1c1
Sequence:CCGGCGGATTCTTTCGCCGTTCGCTCTCGAGAGCGAACGGCGAAAGAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032452
JPH4 MISSION shRNA Lentiviral Transduction Particles
junctophilin 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032452.2-2442s21c1
Sequence:CCGGACTAGCTGGCTATGAGGCTGACTCGAGTCAGCCTCATAGCCAGCTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032452.2-2969s21c1
Sequence:CCGCCCTGTCTTCTTTCAGATTATCCTCGAGGATAATCTGAAAGAAGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032452.2-2253s21c1
Sequence:CCGGGGTATATGAGAACGGACTGACCTCGAGGTCAGTCCGTTCTCATATACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032452.1-2118s1c1
Sequence:CCGGAGCTCGAATGGCCAAACTGATCTCGAGATCAGTTTGGCCATTCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032452.1-1041s1c1
Sequence:CCGGCTTCGAGTCACTGGGCGTCTTCTCGAGAAGACGCCCAGTGACTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032452.1-2514s1c1
Sequence:CCGGCAGTTCAGGAAGTCTTCGAGACTCGAGTCTCGAAGACTTCCTGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032452.1-2745s1c1
Sequence:CCGGCCTGGACCTCAGCCTGGCATTCTCGAGAATGCCAGGCTGAGGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032452.1-1551s1c1
Sequence:CCGGCGGATTCTTTCGCCGTTCGCTCTCGAGAGCGAACGGCGAAAGAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003829
JPH4 MISSION shRNA Bacterial Glycerol Stock
junctophilin 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003829.1-2312s1c1
Sequence:CCGGGCGTAATAGTTCTGTGAGATACTCGAGTATCTCACAGAACTATTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003829.1-592s1c1
Sequence:CCGGGCGCCAAAGTGTACCCTACCACTCGAGTGGTAGGGTACACTTTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003829.1-807s1c1
Sequence:CCGGCAGGTGGATTCTTCCGCCGTTCTCGAGAACGGCGGAAGAATCCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003829.1-1363s1c1
Sequence:CCGGTCTGGGTACTAACCACACTTACTCGAGTAAGTGTGGTTAGTACCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003829.1-484s1c1
Sequence:CCGGCGGGCTCTGGAAGGACGGCTTCTCGAGAAGCCGTCCTTCCAGAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003829
JPH4 MISSION shRNA shRNA Plasmid DNA
junctophilin 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003829.1-2312s1c1
Sequence:CCGGGCGTAATAGTTCTGTGAGATACTCGAGTATCTCACAGAACTATTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003829.1-592s1c1
Sequence:CCGGGCGCCAAAGTGTACCCTACCACTCGAGTGGTAGGGTACACTTTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003829.1-807s1c1
Sequence:CCGGCAGGTGGATTCTTCCGCCGTTCTCGAGAACGGCGGAAGAATCCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003829.1-1363s1c1
Sequence:CCGGTCTGGGTACTAACCACACTTACTCGAGTAAGTGTGGTTAGTACCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003829.1-484s1c1
Sequence:CCGGCGGGCTCTGGAAGGACGGCTTCTCGAGAAGCCGTCCTTCCAGAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003829
JPH4 MISSION shRNA Lentiviral Transduction Particles
junctophilin 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003829.1-2312s1c1
Sequence:CCGGGCGTAATAGTTCTGTGAGATACTCGAGTATCTCACAGAACTATTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003829.1-592s1c1
Sequence:CCGGGCGCCAAAGTGTACCCTACCACTCGAGTGGTAGGGTACACTTTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003829.1-807s1c1
Sequence:CCGGCAGGTGGATTCTTCCGCCGTTCTCGAGAACGGCGGAAGAATCCACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003829.1-1363s1c1
Sequence:CCGGTCTGGGTACTAACCACACTTACTCGAGTAAGTGTGGTTAGTACCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003829.1-484s1c1
Sequence:CCGGCGGGCTCTGGAAGGACGGCTTCTCGAGAAGCCGTCCTTCCAGAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)