EMAIL THIS PAGE TO A FRIEND

JRKL

jerky homolog-like (mouse)

106 Gene Product Result for
Synonyms: HHMJG
UniProtKB ID: Q9Y4A0, A8K3G4, B2RAJ3, Q32MC2
Gene ID:
Human(8690) Summary: The function of this gene has not yet been defined, however, the encoded protein shares similarity with the human (41% identical) and mouse (34% identical) jerky gene products. This protein may act as a nuclear regulatory protein. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
Mouse(77532) jerky homolog-like (mouse)
Rat(315417) jerky homolog-like (mouse)
naked mole-rat(101722708) jerky homolog-like (mouse)
sheep(101122885) jerky homolog-like (mouse)
dog(476764) jerky homolog-like (mouse)
cow(539736) jerky homolog-like (mouse)
domestic cat(101100664) jerky homolog-like (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003772 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003772 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003772 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001472472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001472472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001472472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005131 MISSION® esiRNA esiRNA targeting human JRKL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003772 Rosetta Predictions human pricing
NM_001108122 Rosetta Predictions rat pricing
XM_001472472 Rosetta Predictions mouse pricing
XM_910652 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135540 predicted 1834
2 SASI_Hs01_00135541 predicted 1496
3 SASI_Hs01_00135542 predicted 1593
4 SASI_Hs01_00135543 predicted 1769
5 SASI_Hs01_00135544 predicted 1798
6 SASI_Hs01_00135545 predicted 1409
7 SASI_Hs01_00135547 predicted 1694
8 SASI_Hs01_00135548 predicted 1287
9 SASI_Hs01_00135549 predicted 214
10 SASI_Hs02_00336266 predicted 1302
11 SASI_Hs01_00135546 predicted 1776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235574 predicted 1010
2 SASI_Rn02_00235575 predicted 1589
3 SASI_Rn02_00235576 predicted 911
4 SASI_Rn02_00235577 predicted 1324
5 SASI_Rn02_00235578 predicted 391
6 SASI_Rn02_00235579 predicted 213
7 SASI_Rn02_00235580 predicted 1568
8 SASI_Rn02_00235581 predicted 682
9 SASI_Rn02_00235582 predicted 240
10 SASI_Rn02_00235583 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001472472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00361735 predicted 1117
2 SASI_Mm02_00361736 predicted 1008
3 SASI_Mm02_00361737 predicted 1691
4 SASI_Mm02_00361738 predicted 1561
5 SASI_Mm02_00361739 predicted 1293
6 SASI_Mm02_00361740 predicted 953
7 SASI_Mm02_00361741 predicted 281
8 SASI_Mm02_00361742 predicted 266
9 SASI_Mm02_00361743 predicted 572
10 SASI_Mm02_00361744 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435775 predicted 1116
2 SASI_Mm02_00435776 predicted 1008
3 SASI_Mm02_00435777 predicted 1693
4 SASI_Mm02_00435778 predicted 1559
5 SASI_Mm02_00435779 predicted 1296
6 SASI_Mm02_00435780 predicted 953
7 SASI_Mm02_00435781 predicted 280
8 SASI_Mm02_00435782 predicted 269
9 SASI_Mm02_00435783 predicted 569
10 SASI_Mm02_00435784 predicted 1201
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003772
JRKL MISSION shRNA Bacterial Glycerol Stock
jerky homolog-like (mouse)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003772.3-1367s21c1
Sequence:CCGGTAAATCAACTGACACCTTAAACTCGAGTTTAAGGTGTCAGTTGATTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003772.3-1982s21c1
Sequence:CCGGAGTGTTAACTGATAGCGAAATCTCGAGATTTCGCTATCAGTTAACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003772.3-771s21c1
Sequence:CCGGGAAACAACAGTTCGGGATATACTCGAGTATATCCCGAACTGTTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003772.2-813s1c1
Sequence:CCGGGCCGCAAGTTCGAGAGTATTTCTCGAGAAATACTCTCGAACTTGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003772.2-2210s1c1
Sequence:CCGGGCTGATCTATAAAGAGGCATTCTCGAGAATGCCTCTTTATAGATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003772.2-1599s1c1
Sequence:CCGGGCTCATTGTGTTTGTGACAAACTCGAGTTTGTCACAAACACAATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003772.2-1042s1c1
Sequence:CCGGGAAGAAGGTAATGACCTGAAACTCGAGTTTCAGGTCATTACCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003772.2-1487s1c1
Sequence:CCGGGTGATATGATTCTACCTGATACTCGAGTATCAGGTAGAATCATATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003772.2-994s1c1
Sequence:CCGGGCAACGATGAAGAGAAATTATCTCGAGATAATTTCTCTTCATCGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003772.2-2183s1c1
Sequence:CCGGGCCAAATGAGAGAGAAACTATCTCGAGATAGTTTCTCTCTCATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003772
JRKL MISSION shRNA shRNA Plasmid DNA
jerky homolog-like (mouse)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003772.3-1367s21c1
Sequence:CCGGTAAATCAACTGACACCTTAAACTCGAGTTTAAGGTGTCAGTTGATTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003772.3-1982s21c1
Sequence:CCGGAGTGTTAACTGATAGCGAAATCTCGAGATTTCGCTATCAGTTAACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003772.3-771s21c1
Sequence:CCGGGAAACAACAGTTCGGGATATACTCGAGTATATCCCGAACTGTTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003772.2-813s1c1
Sequence:CCGGGCCGCAAGTTCGAGAGTATTTCTCGAGAAATACTCTCGAACTTGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003772.2-2210s1c1
Sequence:CCGGGCTGATCTATAAAGAGGCATTCTCGAGAATGCCTCTTTATAGATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003772.2-1599s1c1
Sequence:CCGGGCTCATTGTGTTTGTGACAAACTCGAGTTTGTCACAAACACAATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003772.2-1042s1c1
Sequence:CCGGGAAGAAGGTAATGACCTGAAACTCGAGTTTCAGGTCATTACCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003772.2-1487s1c1
Sequence:CCGGGTGATATGATTCTACCTGATACTCGAGTATCAGGTAGAATCATATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003772.2-994s1c1
Sequence:CCGGGCAACGATGAAGAGAAATTATCTCGAGATAATTTCTCTTCATCGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003772.2-2183s1c1
Sequence:CCGGGCCAAATGAGAGAGAAACTATCTCGAGATAGTTTCTCTCTCATTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003772
JRKL MISSION shRNA Lentiviral Transduction Particles
jerky homolog-like (mouse)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003772.3-1367s21c1
Sequence:CCGGTAAATCAACTGACACCTTAAACTCGAGTTTAAGGTGTCAGTTGATTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003772.3-1982s21c1
Sequence:CCGGAGTGTTAACTGATAGCGAAATCTCGAGATTTCGCTATCAGTTAACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003772.3-771s21c1
Sequence:CCGGGAAACAACAGTTCGGGATATACTCGAGTATATCCCGAACTGTTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003772.2-813s1c1
Sequence:CCGGGCCGCAAGTTCGAGAGTATTTCTCGAGAAATACTCTCGAACTTGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003772.2-2210s1c1
Sequence:CCGGGCTGATCTATAAAGAGGCATTCTCGAGAATGCCTCTTTATAGATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003772.2-1599s1c1
Sequence:CCGGGCTCATTGTGTTTGTGACAAACTCGAGTTTGTCACAAACACAATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003772.2-1042s1c1
Sequence:CCGGGAAGAAGGTAATGACCTGAAACTCGAGTTTCAGGTCATTACCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003772.2-1487s1c1
Sequence:CCGGGTGATATGATTCTACCTGATACTCGAGTATCAGGTAGAATCATATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003772.2-994s1c1
Sequence:CCGGGCAACGATGAAGAGAAATTATCTCGAGATAATTTCTCTTCATCGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003772.2-2183s1c1
Sequence:CCGGGCCAAATGAGAGAGAAACTATCTCGAGATAGTTTCTCTCTCATTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001472472
JRKL MISSION shRNA Bacterial Glycerol Stock
jerky homolog-like (mouse)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001472472.1-544s21c1
Sequence:CCGGTGGTTGGTTAACACGCTTTAACTCGAGTTAAAGCGTGTTAACCAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001472472.1-886s21c1
Sequence:GTACCGGCAAGTCAACTGACACCTTAAACTCGAGTTTAAGGTGTCAGTTGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001472472.1-1671s21c1
Sequence:CCGGTACCTGACAGACTGGTAATACCTCGAGGTATTACCAGTCTGTCAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001472472.1-2080s21c1
Sequence:CCGGTTCTTGTGCTAACCATATTAACTCGAGTTAATATGGTTAGCACAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001472472.1-998s21c1
Sequence:CCGGCGAGAGTACTTAAGATCTAAACTCGAGTTTAGATCTTAAGTACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001472472
JRKL MISSION shRNA shRNA Plasmid DNA
jerky homolog-like (mouse)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001472472.1-544s21c1
Sequence:CCGGTGGTTGGTTAACACGCTTTAACTCGAGTTAAAGCGTGTTAACCAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001472472.1-886s21c1
Sequence:GTACCGGCAAGTCAACTGACACCTTAAACTCGAGTTTAAGGTGTCAGTTGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001472472.1-1671s21c1
Sequence:CCGGTACCTGACAGACTGGTAATACCTCGAGGTATTACCAGTCTGTCAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001472472.1-2080s21c1
Sequence:CCGGTTCTTGTGCTAACCATATTAACTCGAGTTAATATGGTTAGCACAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001472472.1-998s21c1
Sequence:CCGGCGAGAGTACTTAAGATCTAAACTCGAGTTTAGATCTTAAGTACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001472472
JRKL MISSION shRNA Lentiviral Transduction Particles
jerky homolog-like (mouse)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001472472.1-544s21c1
Sequence:CCGGTGGTTGGTTAACACGCTTTAACTCGAGTTAAAGCGTGTTAACCAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001472472.1-886s21c1
Sequence:GTACCGGCAAGTCAACTGACACCTTAAACTCGAGTTTAAGGTGTCAGTTGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001472472.1-1671s21c1
Sequence:CCGGTACCTGACAGACTGGTAATACCTCGAGGTATTACCAGTCTGTCAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001472472.1-2080s21c1
Sequence:CCGGTTCTTGTGCTAACCATATTAACTCGAGTTAATATGGTTAGCACAAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001472472.1-998s21c1
Sequence:CCGGCGAGAGTACTTAAGATCTAAACTCGAGTTTAGATCTTAAGTACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)