EMAIL THIS PAGE TO A FRIEND

JSRP1

junctional sarcoplasmic reticulum protein 1

42 Gene Product Result for
Synonyms: JP-45 JP45
UniProtKB ID: Q96MG2
Gene ID:
Human(126306) Summary: The protein encoded by this gene is involved in excitation-contraction coupling at the sarcoplasmic reticulum. The encoded protein can interact with CACNA1S, CACNB1, and calsequestrin to help regulate calcium influx and efflux in skeletal muscle. [provided by RefSeq, Jul 2012]
Mouse(71912) junctional sarcoplasmic reticulum protein 1
Rat(690423) junctional sarcoplasmic reticulum protein 1
naked mole-rat(101712353) junctional sarcoplasmic reticulum protein 1
cow(509378) junctional sarcoplasmic reticulum protein 1
dog(612184) junctional sarcoplasmic reticulum protein 1
domestic cat(101080513) junctional sarcoplasmic reticulum protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028001 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028001 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028001 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144616 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144616 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144616 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144616 Rosetta Predictions human pricing
NM_001109591 Rosetta Predictions rat pricing
NM_028001 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238006 predicted 384
2 SASI_Hs01_00238007 predicted 1069
3 SASI_Hs01_00238008 predicted 566
4 SASI_Hs01_00238009 predicted 975
5 SASI_Hs01_00238010 predicted 604
6 SASI_Hs01_00238011 predicted 677
7 SASI_Hs01_00238012 predicted 647
8 SASI_Hs01_00238013 predicted 688
9 SASI_Hs02_00364438 predicted 508
10 SASI_Hs01_00238014 predicted 1067
11 SASI_Hs01_00238005 predicted 131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249891 predicted 452
2 SASI_Rn02_00249892 predicted 535
3 SASI_Rn02_00249893 predicted 241
4 SASI_Rn02_00249894 predicted 523
5 SASI_Rn02_00249895 predicted 458
6 SASI_Rn02_00249896 predicted 236
7 SASI_Rn02_00249897 predicted 204
8 SASI_Rn02_00249898 predicted 265
9 SASI_Rn02_00249899 predicted 330
10 SASI_Rn02_00249900 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028001 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101586 predicted 982
2 SASI_Mm01_00101587 predicted 1052
3 SASI_Mm01_00101588 predicted 1047
4 SASI_Mm01_00101589 predicted 676
5 SASI_Mm02_00333098 predicted 1024
6 SASI_Mm01_00101591 predicted 980
7 SASI_Mm01_00101592 predicted 466
8 SASI_Mm01_00101593 predicted 766
9 SASI_Mm01_00101594 predicted 518
10 SASI_Mm01_00101595 predicted 1044
11 SASI_Mm01_00101590 predicted 626
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028001
JSRP1 MISSION shRNA Bacterial Glycerol Stock
junctional sarcoplasmic reticulum protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028001.1-989s1c1
Sequence:CCGGCGGAAAGAGAAGCCAAGTAAACTCGAGTTTACTTGGCTTCTCTTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028001.1-1058s1c1
Sequence:CCGGGAGGATAAGTCACAGGTCACTCTCGAGAGTGACCTGTGACTTATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028001.2-1044s21c1
Sequence:CCGGGAAGCCGAGGAGAGAGGATAACTCGAGTTATCCTCTCTCCTCGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028001.2-1019s21c1
Sequence:CCGGTGAAGAAGGAGAAGCCGAGAACTCGAGTTCTCGGCTTCTCCTTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028001.2-625s21c1
Sequence:CCGGGGAGATCTGACGCTCAACAAGCTCGAGCTTGTTGAGCGTCAGATCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028001.2-908s21c1
Sequence:CCGGTAGAACGTGGAGGGTCCATCTCTCGAGAGATGGACCCTCCACGTTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028001.2-989s21c1
Sequence:CCGGGGAAAGAGAAGCCAAGTAAAGCTCGAGCTTTACTTGGCTTCTCTTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028001
JSRP1 MISSION shRNA shRNA Plasmid DNA
junctional sarcoplasmic reticulum protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028001.1-989s1c1
Sequence:CCGGCGGAAAGAGAAGCCAAGTAAACTCGAGTTTACTTGGCTTCTCTTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028001.1-1058s1c1
Sequence:CCGGGAGGATAAGTCACAGGTCACTCTCGAGAGTGACCTGTGACTTATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028001.2-1044s21c1
Sequence:CCGGGAAGCCGAGGAGAGAGGATAACTCGAGTTATCCTCTCTCCTCGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028001.2-1019s21c1
Sequence:CCGGTGAAGAAGGAGAAGCCGAGAACTCGAGTTCTCGGCTTCTCCTTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028001.2-625s21c1
Sequence:CCGGGGAGATCTGACGCTCAACAAGCTCGAGCTTGTTGAGCGTCAGATCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028001.2-908s21c1
Sequence:CCGGTAGAACGTGGAGGGTCCATCTCTCGAGAGATGGACCCTCCACGTTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028001.2-989s21c1
Sequence:CCGGGGAAAGAGAAGCCAAGTAAAGCTCGAGCTTTACTTGGCTTCTCTTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028001
JSRP1 MISSION shRNA Lentiviral Transduction Particles
junctional sarcoplasmic reticulum protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028001.1-989s1c1
Sequence:CCGGCGGAAAGAGAAGCCAAGTAAACTCGAGTTTACTTGGCTTCTCTTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028001.1-1058s1c1
Sequence:CCGGGAGGATAAGTCACAGGTCACTCTCGAGAGTGACCTGTGACTTATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028001.2-1044s21c1
Sequence:CCGGGAAGCCGAGGAGAGAGGATAACTCGAGTTATCCTCTCTCCTCGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028001.2-1019s21c1
Sequence:CCGGTGAAGAAGGAGAAGCCGAGAACTCGAGTTCTCGGCTTCTCCTTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028001.2-625s21c1
Sequence:CCGGGGAGATCTGACGCTCAACAAGCTCGAGCTTGTTGAGCGTCAGATCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028001.2-908s21c1
Sequence:CCGGTAGAACGTGGAGGGTCCATCTCTCGAGAGATGGACCCTCCACGTTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028001.2-989s21c1
Sequence:CCGGGGAAAGAGAAGCCAAGTAAAGCTCGAGCTTTACTTGGCTTCTCTTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144616
JSRP1 MISSION shRNA Bacterial Glycerol Stock
junctional sarcoplasmic reticulum protein 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000243230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144616.2-790s21c1
Sequence:CCGGAGGAGGAGAGACCTAAGAAAGCTCGAGCTTTCTTAGGTCTCTCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144616.2-656s21c1
Sequence:CCGGTGCAGAGAACGACGAAGAGGACTCGAGTCCTCTTCGTCGTTCTCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144616.2-394s21c1
Sequence:CCGGGAGACCTGTCGCTCAACAAGTCTCGAGACTTGTTGAGCGACAGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144616.2-209s21c1
Sequence:CCGGTGTGGACACCAGGCCCAAGAACTCGAGTTCTTGGGCCTGGTGTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144616
JSRP1 MISSION shRNA shRNA Plasmid DNA
junctional sarcoplasmic reticulum protein 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000243230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144616.2-790s21c1
Sequence:CCGGAGGAGGAGAGACCTAAGAAAGCTCGAGCTTTCTTAGGTCTCTCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144616.2-656s21c1
Sequence:CCGGTGCAGAGAACGACGAAGAGGACTCGAGTCCTCTTCGTCGTTCTCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144616.2-394s21c1
Sequence:CCGGGAGACCTGTCGCTCAACAAGTCTCGAGACTTGTTGAGCGACAGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144616.2-209s21c1
Sequence:CCGGTGTGGACACCAGGCCCAAGAACTCGAGTTCTTGGGCCTGGTGTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144616
JSRP1 MISSION shRNA Lentiviral Transduction Particles
junctional sarcoplasmic reticulum protein 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000243230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144616.2-790s21c1
Sequence:CCGGAGGAGGAGAGACCTAAGAAAGCTCGAGCTTTCTTAGGTCTCTCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144616.2-656s21c1
Sequence:CCGGTGCAGAGAACGACGAAGAGGACTCGAGTCCTCTTCGTCGTTCTCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144616.2-394s21c1
Sequence:CCGGGAGACCTGTCGCTCAACAAGTCTCGAGACTTGTTGAGCGACAGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144616.2-209s21c1
Sequence:CCGGTGTGGACACCAGGCCCAAGAACTCGAGTTCTTGGGCCTGGTGTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)