EMAIL THIS PAGE TO A FRIEND

JTB

jumping translocation breakpoint

88 Gene Product Result for
Synonyms: HJTB HSPC222 PAR hJT
UniProtKB ID: O76095, O95442, Q6IB19, Q9P0Q4
Gene ID:
Mouse(23922) jumping translocation breakpoint
Rat(29439) jumping translocation breakpoint
sheep(101102365) jumping translocation breakpoint
domestic guinea pig(100727703) jumping translocation breakpoint
naked mole-rat(101708213) jumping translocation breakpoint
chicken(770053) jumping translocation breakpoint
cow(513970) jumping translocation breakpoint
domestic cat(101100181) jumping translocation breakpoint
dog(612300) jumping translocation breakpoint
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006694 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006694 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006694 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_206924 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_206924 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_206924 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067281 MISSION® esiRNA esiRNA human JTB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006694 Rosetta Predictions human pricing
NM_019213 Rosetta Predictions rat pricing
NM_206924 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342111 predicted 977
2 SASI_Hs01_00010542 predicted 1230
3 SASI_Hs02_00342112 predicted 974
4 SASI_Hs01_00010545 predicted 763
5 SASI_Hs01_00010546 predicted 870
6 SASI_Hs02_00342113 predicted 1328
7 SASI_Hs01_00010548 predicted 1067
8 SASI_Hs02_00342114 predicted 1071
9 SASI_Hs02_00342115 predicted 936
10 SASI_Hs02_00342116 predicted 776
11 SASI_Hs01_00010541 predicted 1200
12 SASI_Hs01_00010543 predicted 1179
13 SASI_Hs01_00010544 predicted 902
14 SASI_Hs01_00010547 predicted 1140
15 SASI_Hs01_00010549 predicted 912
16 SASI_Hs01_00010550 predicted 1023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019213 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092784 predicted 762
2 SASI_Rn02_00262054 predicted 522
3 SASI_Rn01_00092786 predicted 481
4 SASI_Rn01_00092787 predicted 439
5 SASI_Rn01_00092788 predicted 531
6 SASI_Rn01_00092789 predicted 377
7 SASI_Rn01_00092790 predicted 705
8 SASI_Rn01_00092791 predicted 321
9 SASI_Rn01_00092793 predicted 403
10 SASI_Rn02_00262055 predicted 749
11 SASI_Rn01_00092785 predicted 661
12 SASI_Rn01_00092792 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206924 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106798 predicted 616
2 SASI_Mm01_00106799 predicted 747
3 SASI_Mm01_00106801 predicted 864
4 SASI_Mm02_00351831 predicted 578
5 SASI_Mm02_00351832 predicted 535
6 SASI_Mm01_00106803 predicted 848
7 SASI_Mm02_00351833 predicted 692
8 SASI_Mm01_00106804 predicted 875
9 SASI_Mm02_00351834 predicted 744
10 SASI_Mm02_00351835 predicted 495
11 SASI_Mm01_00106797 predicted 747
12 SASI_Mm01_00106800 predicted 779
13 SASI_Mm01_00106802 predicted 494
14 SASI_Mm01_00106805 predicted 876
15 SASI_Mm01_00106806 predicted 619
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006694
VALIDATED
JTB MISSION shRNA Bacterial Glycerol Stock
jumping translocation breakpoint
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006694.3-1012s21c1
Sequence:CCGGCGCTCAGCTTTGATGGAACAACTCGAGTTGTTCCATCAAAGCTGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006694.3-780s21c1
Sequence:CCGGGCTCTGTGCTTTCACCTTAAACTCGAGTTTAAGGTGAAAGCACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006694.3-1215s21c1
Sequence:CCGGGAAAGTGAAATGGACTGATTTCTCGAGAAATCAGTCCATTTCACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006694.3-900s21c1
Sequence:CCGGGTGCTCTCCATGCTCTAATTTCTCGAGAAATTAGAGCATGGAGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006694.2-1215s1c1
Sequence:CCGGGAAAGTGAAATGGACTGATTTCTCGAGAAATCAGTCCATTTCACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006694.2-1012s1c1
Sequence:CCGGCGCTCAGCTTTGATGGAACAACTCGAGTTGTTCCATCAAAGCTGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006694.2-900s1c1
Sequence:CCGGGTGCTCTCCATGCTCTAATTTCTCGAGAAATTAGAGCATGGAGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006694.2-780s1c1
Sequence:CCGGGCTCTGTGCTTTCACCTTAAACTCGAGTTTAAGGTGAAAGCACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006694.2-1141s1c1
Sequence:CCGGCGGAAGCAAATCGAGTCCATACTCGAGTATGGACTCGATTTGCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006694
VALIDATED
JTB MISSION shRNA shRNA Plasmid DNA
jumping translocation breakpoint
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006694.3-1012s21c1
Sequence:CCGGCGCTCAGCTTTGATGGAACAACTCGAGTTGTTCCATCAAAGCTGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006694.3-780s21c1
Sequence:CCGGGCTCTGTGCTTTCACCTTAAACTCGAGTTTAAGGTGAAAGCACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006694.3-1215s21c1
Sequence:CCGGGAAAGTGAAATGGACTGATTTCTCGAGAAATCAGTCCATTTCACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006694.3-900s21c1
Sequence:CCGGGTGCTCTCCATGCTCTAATTTCTCGAGAAATTAGAGCATGGAGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006694.2-1215s1c1
Sequence:CCGGGAAAGTGAAATGGACTGATTTCTCGAGAAATCAGTCCATTTCACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006694.2-1012s1c1
Sequence:CCGGCGCTCAGCTTTGATGGAACAACTCGAGTTGTTCCATCAAAGCTGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006694.2-900s1c1
Sequence:CCGGGTGCTCTCCATGCTCTAATTTCTCGAGAAATTAGAGCATGGAGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006694.2-780s1c1
Sequence:CCGGGCTCTGTGCTTTCACCTTAAACTCGAGTTTAAGGTGAAAGCACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006694.2-1141s1c1
Sequence:CCGGCGGAAGCAAATCGAGTCCATACTCGAGTATGGACTCGATTTGCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006694
VALIDATED
JTB MISSION shRNA Lentiviral Transduction Particles
jumping translocation breakpoint
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006694.3-1012s21c1
Sequence:CCGGCGCTCAGCTTTGATGGAACAACTCGAGTTGTTCCATCAAAGCTGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006694.3-780s21c1
Sequence:CCGGGCTCTGTGCTTTCACCTTAAACTCGAGTTTAAGGTGAAAGCACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006694.3-1215s21c1
Sequence:CCGGGAAAGTGAAATGGACTGATTTCTCGAGAAATCAGTCCATTTCACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006694.3-900s21c1
Sequence:CCGGGTGCTCTCCATGCTCTAATTTCTCGAGAAATTAGAGCATGGAGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006694.2-1215s1c1
Sequence:CCGGGAAAGTGAAATGGACTGATTTCTCGAGAAATCAGTCCATTTCACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006694.2-1012s1c1
Sequence:CCGGCGCTCAGCTTTGATGGAACAACTCGAGTTGTTCCATCAAAGCTGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006694.2-900s1c1
Sequence:CCGGGTGCTCTCCATGCTCTAATTTCTCGAGAAATTAGAGCATGGAGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006694.2-780s1c1
Sequence:CCGGGCTCTGTGCTTTCACCTTAAACTCGAGTTTAAGGTGAAAGCACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006694.2-1141s1c1
Sequence:CCGGCGGAAGCAAATCGAGTCCATACTCGAGTATGGACTCGATTTGCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206924
JTB MISSION shRNA Bacterial Glycerol Stock
jumping translocation breakpoint
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206924.2-548s21c1
Sequence:CCGGTGTTCTAACTTCCAGATTAAACTCGAGTTTAATCTGGAAGTTAGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206924.2-418s21c1
Sequence:CCGGGCTGTGCGCTTTCACCTTAAACTCGAGTTTAAGGTGAAAGCGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206924.1-363s1c1
Sequence:CCGGGCTGTGCGCTTTCACCTTAAACTCGAGTTTAAGGTGAAAGCGCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206924.2-855s21c1
Sequence:CCGGGAAAGTTCAGCGGCTAATTTGCTCGAGCAAATTAGCCGCTGAACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206924.2-790s21c1
Sequence:CCGGTGAGTCCATATAGCTGAATTTCTCGAGAAATTCAGCTATATGGACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206924.2-657s21c1
Sequence:CCGGCTCTACTGGAACAACACTTATCTCGAGATAAGTGTTGTTCCAGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206924.2-923s1c1
Sequence:CCGGGACCATTAATGAGCACAATAACTCGAGTTATTGTGCTCATTAATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206924
JTB MISSION shRNA shRNA Plasmid DNA
jumping translocation breakpoint
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206924.2-548s21c1
Sequence:CCGGTGTTCTAACTTCCAGATTAAACTCGAGTTTAATCTGGAAGTTAGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206924.2-418s21c1
Sequence:CCGGGCTGTGCGCTTTCACCTTAAACTCGAGTTTAAGGTGAAAGCGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206924.1-363s1c1
Sequence:CCGGGCTGTGCGCTTTCACCTTAAACTCGAGTTTAAGGTGAAAGCGCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206924.2-855s21c1
Sequence:CCGGGAAAGTTCAGCGGCTAATTTGCTCGAGCAAATTAGCCGCTGAACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206924.2-790s21c1
Sequence:CCGGTGAGTCCATATAGCTGAATTTCTCGAGAAATTCAGCTATATGGACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206924.2-657s21c1
Sequence:CCGGCTCTACTGGAACAACACTTATCTCGAGATAAGTGTTGTTCCAGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206924.2-923s1c1
Sequence:CCGGGACCATTAATGAGCACAATAACTCGAGTTATTGTGCTCATTAATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206924
JTB MISSION shRNA Lentiviral Transduction Particles
jumping translocation breakpoint
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206924.2-548s21c1
Sequence:CCGGTGTTCTAACTTCCAGATTAAACTCGAGTTTAATCTGGAAGTTAGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206924.2-418s21c1
Sequence:CCGGGCTGTGCGCTTTCACCTTAAACTCGAGTTTAAGGTGAAAGCGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206924.1-363s1c1
Sequence:CCGGGCTGTGCGCTTTCACCTTAAACTCGAGTTTAAGGTGAAAGCGCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206924.2-855s21c1
Sequence:CCGGGAAAGTTCAGCGGCTAATTTGCTCGAGCAAATTAGCCGCTGAACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206924.2-790s21c1
Sequence:CCGGTGAGTCCATATAGCTGAATTTCTCGAGAAATTCAGCTATATGGACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206924.2-657s21c1
Sequence:CCGGCTCTACTGGAACAACACTTATCTCGAGATAAGTGTTGTTCCAGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206924.2-923s1c1
Sequence:CCGGGACCATTAATGAGCACAATAACTCGAGTTATTGTGCTCATTAATGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)