EMAIL THIS PAGE TO A FRIEND

JUN

jun proto-oncogene

169 Gene Product Result for
Synonyms: AP-1 AP1 c-Jun
UniProtKB ID: P05412, Q96G93
Gene ID:
Human(3725) Summary: This gene is the putative transforming gene of avian sarcoma virus 17. It encodes a protein which is highly similar to the viral protein, and which interacts directly with specific target DNA sequences to regulate gene expression. This gene is intronless and is mapped to 1p32-p31, a chromosomal region involved in both translocations and deletions in human malignancies. [provided by RefSeq, Jul 2008]
Mouse(16476) Jun oncogene
Rat(24516) jun proto-oncogene
Zebrafish(335916) jun proto-oncogene
cow(280831) jun proto-oncogene
domestic cat(100271848) jun proto-oncogene
domestic cat(101097261) jun proto-oncogene
dog(609429) jun proto-oncogene
chicken(424673) jun proto-oncogene
domestic guinea pig(100728775) jun proto-oncogene
naked mole-rat(101722197) jun proto-oncogene
sheep(100170668) jun proto-oncogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW21143 Anti-AP-1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat, mouse
western blot pricing
A5968 Anti-AP-1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, microarray, western blot pricing
J104 Anti-c-Jun antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse
western blot pricing
SAB4501604 Anti-C-JUN antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501606 Anti-C-JUN antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4501607 Anti-C-JUN antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4501608 Anti-C-JUN antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501609 Anti-C-JUN antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4501610 Anti-C-JUN antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501611 Anti-C-JUN antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4501612 Anti-C-JUN antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501605 Anti-C-JUN, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4300307 Anti-JUN (Ab-170) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4300308 Anti-JUN (Ab-239) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB4300309 Anti-JUN (Ab-243) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300286 Anti-JUN (Ab-63) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4300288 Anti-JUN (Ab-73) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4300305 Anti-JUN (Ab-91) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300306 Anti-JUN (Ab-93) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
AV100614 Anti-JUN (AB1) antibody produced in rabbit affinity isolated antibody sheep, rabbit, human, pig, rat, mouse, bovine, canine
western blot pricing
AV100708 Anti-JUN (AB2) antibody produced in rabbit affinity isolated antibody pig, canine, bovine, mouse, zebrafish, sheep, rat, human
western blot pricing
AV100911 Anti-JUN (AB3) antibody produced in rabbit affinity isolated antibody bovine, mouse, rat, sheep, human, pig, rabbit, canine
western blot pricing
SAB1406055 Anti-JUN antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
proximity ligation assay, western blot pricing
AV38133 Anti-JUN antibody produced in rabbit IgG fraction of antiserum zebrafish, mouse, pig, bovine, rabbit, guinea pig, canine, human, rat
western blot pricing
SAB2103656 Anti-JUN antibody produced in rabbit affinity isolated antibody mouse, rat, zebrafish, horse, canine, sheep, human, guinea pig, goat, rabbit, bovine, pig
western blot pricing
HPA059474 Anti-JUN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4504451 Anti-phospho-c-Jun (pSer243) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
J2128 Anti-phospho-c-Jun (pSer63) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
flow cytometry, microarray, western blot pricing
SAB4504368 Anti-phospho-c-Jun (pSer63) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301276 Anti-phospho-c-Jun (pSer63) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
J2253 Anti-phospho-c-Jun (pSer73) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human, mouse
microarray, western blot pricing
SAB4504369 Anti-phospho-c-Jun (pSer73) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504452 Anti-phospho-c-Jun (pThr239) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4504453 Anti-phospho-c-Jun (pThr91) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504454 Anti-phospho-c-Jun (pThr93) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504455 Anti-phospho-c-Jun (pTyr170) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB1306608 ANTI-PHOSPHO-CJUN(S63) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1306607 ANTI-PHOSPHO-CJUN(S63) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4300015 Anti-phospho-JUN (pSer243) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4300002 Anti-phospho-JUN (pSer73) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4300014 Anti-phospho-JUN (pThr239) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300011 Anti-phospho-JUN (pThr91) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4300012 Anti-phospho-JUN (pThr93) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4300013 Anti-phospho-JUN (pTyr170) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB5300271 Monoclonal Anti-JUN antibody produced in mouse clone 5B1, ascites fluid mouse, human, monkey
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300272 Monoclonal Anti-JUN antibody produced in mouse clone 4H9, ascites fluid human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4100540 Monoclonal Anti-JUN antibody produced in mouse clone JUN-A487, culture supernatant human
western blot pricing
SAB4100541 Monoclonal Anti-JUN antibody produced in mouse clone JUN-B487, culture supernatant human
western blot pricing
J4399 Monoclonal Anti-phospho-c-Jun (pThr91,93) antibody produced in mouse ~2 mg/mL, clone C-J 4C4/1, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
PLA0273 Rabbit anti-c-Jun Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, gorilla, human, gibbon
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S5567 SP600125 ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010591 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010591 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010591 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002228 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002228 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002228 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002228 Rosetta Predictions human pricing
NM_021835 Rosetta Predictions rat pricing
NM_010591 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333461 predicted 1047
2 SASI_Hs01_00150279 predicted 1063
3 SASI_Hs01_00150278 predicted 1269
4 SASI_Hs01_00150282 predicted 2413
5 SASI_Hs01_00150283 predicted 2348
6 SASI_Hs02_00333462 predicted 2342
7 SASI_Hs02_00333463 predicted 2418
8 SASI_Hs01_00150287 predicted 2423
9 SASI_Hs02_00333464 predicted 2197
10 SASI_Hs02_00333465 predicted 2423
11 SASI_Hs01_00150280 predicted 1959
12 SASI_Hs01_00150281 predicted 1711
13 SASI_Hs01_00150284 predicted 2018
14 SASI_Hs01_00150285 predicted 1980
15 SASI_Hs01_00150286 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021835 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038148 predicted 915
2 SASI_Rn01_00038149 predicted 947
3 SASI_Rn01_00038150 predicted 1620
4 SASI_Rn01_00038151 predicted 1620
5 SASI_Rn01_00038152 predicted 1329
6 SASI_Rn01_00038153 predicted 896
7 SASI_Rn01_00038155 predicted 941
8 SASI_Rn01_00038156 predicted 1016
9 SASI_Rn01_00038157 predicted 935
10 SASI_Rn02_00262836 predicted 2165
11 SASI_Rn01_00038154 predicted 1631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046356 predicted 1031
2 SASI_Mm01_00046357 predicted 1014
3 SASI_Mm01_00046358 predicted 1032
4 SASI_Mm01_00046360 predicted 2164
5 SASI_Mm02_00318894 predicted 2318
6 SASI_Mm01_00046362 predicted 2252
7 SASI_Mm02_00318895 predicted 2258
8 SASI_Mm02_00318896 predicted 2332
9 SASI_Mm01_00046359 predicted 990
10 SASI_Mm02_00318897 predicted 2102
11 SASI_Mm01_00046361 predicted 1833
12 SASI_Mm01_00046363 predicted 1678
13 SASI_Mm01_00046364 predicted 1716
14 SASI_Mm01_00046365 predicted 1858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010591
JUN MISSION shRNA Bacterial Glycerol Stock
jun proto-oncogene
Mouse
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1804s1c1
Sequence:CCGGGCTGGCATCCACGGCCAACATCTCGAGATGTTGGCCGTGGATGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1678s1c1
Sequence:CCGGGCGGATCAAGGCAGAGAGGAACTCGAGTTCCTCTCTGCCTTGATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1272s1c1
Sequence:CCGGCTGAACTGCATAGCCAGAACACTCGAGTGTTCTGGCTATGCAGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-985s1c1
Sequence:CCGGCGGTGCCTACGGCTACAGTAACTCGAGTTACTGTAGCCGTAGGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1696s1c1
Sequence:CCGGGAAGCGCATGAGGAACCGCATCTCGAGATGCGGTTCCTCATGCGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1000s1c1
Sequence:CCGGCAGTAACCCTAAGATCCTAAACTCGAGTTTAGGATCTTAGGGTTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1846s1c1
Sequence:CCGGGCTTAAGCAGAAAGTCATGAACTCGAGTTCATGACTTTCTGCTTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1898s1c1
Sequence:CCGGACGCAGCAGTTGCAAACGTTTCTCGAGAAACGTTTGCAACTGCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-994s1c1
Sequence:CCGGCGGCTACAGTAACCCTAAGATCTCGAGATCTTAGGGTTACTGTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1423s1c1
Sequence:CCGGCTACGCCAACCTCAGCAACTTCTCGAGAAGTTGCTGAGGTTGGCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1787s21c1
Sequence:CCGGGGATCGCTCGGCTAGAGGAAACTCGAGTTTCCTCTAGCCGAGCGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1890s21c1
Sequence:GTACCGGGAAAGTCATGAACCACGTTAACTCGAGTTAACGTGGTTCATGACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1929s21c1
Sequence:CCGGGCTAACGCAGCAGTTGCAAACCTCGAGGTTTGCAACTGCTGCGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1867s21c1
Sequence:CCGGGAACAGGTGGCACAGCTTAAGCTCGAGCTTAAGCTGTGCCACCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1035s21c1
Sequence:CCGGCAGTAACCCTAAGATCCTAAACTCGAGTTTAGGATCTTAGGGTTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010591.2-2270s21c1
Sequence:CCGGATTCGATCTCATTCAGTATTACTCGAGTAATACTGAATGAGATCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010591.2-2439s21c1
Sequence:CCGGCTCAACTGTGTATGTACATATCTCGAGATATGTACATACACAGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1733s21c1
Sequence:CCGGAGCGCATGAGGAACCGCATTGCTCGAGCAATGCGGTTCCTCATGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1690s21c1
Sequence:CCGGCCTATCGACATGGAGTCTCAGCTCGAGCTGAGACTCCATGTCGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010591
JUN MISSION shRNA shRNA Plasmid DNA
jun proto-oncogene
Mouse
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1804s1c1
Sequence:CCGGGCTGGCATCCACGGCCAACATCTCGAGATGTTGGCCGTGGATGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1678s1c1
Sequence:CCGGGCGGATCAAGGCAGAGAGGAACTCGAGTTCCTCTCTGCCTTGATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1272s1c1
Sequence:CCGGCTGAACTGCATAGCCAGAACACTCGAGTGTTCTGGCTATGCAGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-985s1c1
Sequence:CCGGCGGTGCCTACGGCTACAGTAACTCGAGTTACTGTAGCCGTAGGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1696s1c1
Sequence:CCGGGAAGCGCATGAGGAACCGCATCTCGAGATGCGGTTCCTCATGCGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1000s1c1
Sequence:CCGGCAGTAACCCTAAGATCCTAAACTCGAGTTTAGGATCTTAGGGTTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1846s1c1
Sequence:CCGGGCTTAAGCAGAAAGTCATGAACTCGAGTTCATGACTTTCTGCTTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1898s1c1
Sequence:CCGGACGCAGCAGTTGCAAACGTTTCTCGAGAAACGTTTGCAACTGCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-994s1c1
Sequence:CCGGCGGCTACAGTAACCCTAAGATCTCGAGATCTTAGGGTTACTGTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1423s1c1
Sequence:CCGGCTACGCCAACCTCAGCAACTTCTCGAGAAGTTGCTGAGGTTGGCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1787s21c1
Sequence:CCGGGGATCGCTCGGCTAGAGGAAACTCGAGTTTCCTCTAGCCGAGCGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1890s21c1
Sequence:GTACCGGGAAAGTCATGAACCACGTTAACTCGAGTTAACGTGGTTCATGACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1929s21c1
Sequence:CCGGGCTAACGCAGCAGTTGCAAACCTCGAGGTTTGCAACTGCTGCGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1867s21c1
Sequence:CCGGGAACAGGTGGCACAGCTTAAGCTCGAGCTTAAGCTGTGCCACCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1035s21c1
Sequence:CCGGCAGTAACCCTAAGATCCTAAACTCGAGTTTAGGATCTTAGGGTTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010591.2-2270s21c1
Sequence:CCGGATTCGATCTCATTCAGTATTACTCGAGTAATACTGAATGAGATCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010591.2-2439s21c1
Sequence:CCGGCTCAACTGTGTATGTACATATCTCGAGATATGTACATACACAGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1733s21c1
Sequence:CCGGAGCGCATGAGGAACCGCATTGCTCGAGCAATGCGGTTCCTCATGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1690s21c1
Sequence:CCGGCCTATCGACATGGAGTCTCAGCTCGAGCTGAGACTCCATGTCGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010591
JUN MISSION shRNA Lentiviral Transduction Particles
jun proto-oncogene
Mouse
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1804s1c1
Sequence:CCGGGCTGGCATCCACGGCCAACATCTCGAGATGTTGGCCGTGGATGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1678s1c1
Sequence:CCGGGCGGATCAAGGCAGAGAGGAACTCGAGTTCCTCTCTGCCTTGATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1272s1c1
Sequence:CCGGCTGAACTGCATAGCCAGAACACTCGAGTGTTCTGGCTATGCAGTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-985s1c1
Sequence:CCGGCGGTGCCTACGGCTACAGTAACTCGAGTTACTGTAGCCGTAGGCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1696s1c1
Sequence:CCGGGAAGCGCATGAGGAACCGCATCTCGAGATGCGGTTCCTCATGCGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1000s1c1
Sequence:CCGGCAGTAACCCTAAGATCCTAAACTCGAGTTTAGGATCTTAGGGTTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1846s1c1
Sequence:CCGGGCTTAAGCAGAAAGTCATGAACTCGAGTTCATGACTTTCTGCTTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1898s1c1
Sequence:CCGGACGCAGCAGTTGCAAACGTTTCTCGAGAAACGTTTGCAACTGCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-994s1c1
Sequence:CCGGCGGCTACAGTAACCCTAAGATCTCGAGATCTTAGGGTTACTGTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010591.1-1423s1c1
Sequence:CCGGCTACGCCAACCTCAGCAACTTCTCGAGAAGTTGCTGAGGTTGGCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1787s21c1
Sequence:CCGGGGATCGCTCGGCTAGAGGAAACTCGAGTTTCCTCTAGCCGAGCGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1890s21c1
Sequence:GTACCGGGAAAGTCATGAACCACGTTAACTCGAGTTAACGTGGTTCATGACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1929s21c1
Sequence:CCGGGCTAACGCAGCAGTTGCAAACCTCGAGGTTTGCAACTGCTGCGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1867s21c1
Sequence:CCGGGAACAGGTGGCACAGCTTAAGCTCGAGCTTAAGCTGTGCCACCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1035s21c1
Sequence:CCGGCAGTAACCCTAAGATCCTAAACTCGAGTTTAGGATCTTAGGGTTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010591.2-2270s21c1
Sequence:CCGGATTCGATCTCATTCAGTATTACTCGAGTAATACTGAATGAGATCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010591.2-2439s21c1
Sequence:CCGGCTCAACTGTGTATGTACATATCTCGAGATATGTACATACACAGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1733s21c1
Sequence:CCGGAGCGCATGAGGAACCGCATTGCTCGAGCAATGCGGTTCCTCATGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010591.2-1690s21c1
Sequence:CCGGCCTATCGACATGGAGTCTCAGCTCGAGCTGAGACTCCATGTCGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002228
VALIDATED
JUN MISSION shRNA Bacterial Glycerol Stock
jun proto-oncogene
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002228.2-1484s1c1
Sequence:CCGGCGCAAACCTCAGCAACTTCAACTCGAGTTGAAGTTGCTGAGGTTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002228.2-1043s1c1
Sequence:CCGGCGGACCTTATGGCTACAGTAACTCGAGTTACTGTAGCCATAAGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002228.2-2919s1c1
Sequence:CCGGCCAGCGTATCTATATGGAATTCTCGAGAATTCCATATAGATACGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002228.2-1208s1c1
Sequence:CCGGCCTGATAATCCAGTCCAGCAACTCGAGTTGCTGGACTGGATTATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002228.2-1937s1c1
Sequence:CCGGACTCATGCTAACGCAGCAGTTCTCGAGAACTGCTGCGTTAGCATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002228.3-2528s21c1
Sequence:CCGGTTCTGGCCTGCCTTCGTTAACCTCGAGGTTAACGAAGGCAGGCCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002228.3-1986s21c1
Sequence:CCGGCACGTTAACAGTGGGTGCCAACTCGAGTTGGCACCCACTGTTAACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002228.3-1997s21c1
Sequence:CCGGTGGGTGCCAACTCATGCTAACCTCGAGGTTAGCATGAGTTGGCACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002228
VALIDATED
JUN MISSION shRNA shRNA Plasmid DNA
jun proto-oncogene
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002228.2-1484s1c1
Sequence:CCGGCGCAAACCTCAGCAACTTCAACTCGAGTTGAAGTTGCTGAGGTTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002228.2-1043s1c1
Sequence:CCGGCGGACCTTATGGCTACAGTAACTCGAGTTACTGTAGCCATAAGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002228.2-2919s1c1
Sequence:CCGGCCAGCGTATCTATATGGAATTCTCGAGAATTCCATATAGATACGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002228.2-1208s1c1
Sequence:CCGGCCTGATAATCCAGTCCAGCAACTCGAGTTGCTGGACTGGATTATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002228.2-1937s1c1
Sequence:CCGGACTCATGCTAACGCAGCAGTTCTCGAGAACTGCTGCGTTAGCATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002228.3-2528s21c1
Sequence:CCGGTTCTGGCCTGCCTTCGTTAACCTCGAGGTTAACGAAGGCAGGCCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002228.3-1986s21c1
Sequence:CCGGCACGTTAACAGTGGGTGCCAACTCGAGTTGGCACCCACTGTTAACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002228.3-1997s21c1
Sequence:CCGGTGGGTGCCAACTCATGCTAACCTCGAGGTTAGCATGAGTTGGCACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002228
VALIDATED
JUN MISSION shRNA Lentiviral Transduction Particles
jun proto-oncogene
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002228.2-1484s1c1
Sequence:CCGGCGCAAACCTCAGCAACTTCAACTCGAGTTGAAGTTGCTGAGGTTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002228.2-1043s1c1
Sequence:CCGGCGGACCTTATGGCTACAGTAACTCGAGTTACTGTAGCCATAAGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002228.2-2919s1c1
Sequence:CCGGCCAGCGTATCTATATGGAATTCTCGAGAATTCCATATAGATACGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002228.2-1208s1c1
Sequence:CCGGCCTGATAATCCAGTCCAGCAACTCGAGTTGCTGGACTGGATTATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002228.2-1937s1c1
Sequence:CCGGACTCATGCTAACGCAGCAGTTCTCGAGAACTGCTGCGTTAGCATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002228.3-2528s21c1
Sequence:CCGGTTCTGGCCTGCCTTCGTTAACCTCGAGGTTAACGAAGGCAGGCCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002228.3-1986s21c1
Sequence:CCGGCACGTTAACAGTGGGTGCCAACTCGAGTTGGCACCCACTGTTAACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002228.3-1997s21c1
Sequence:CCGGTGGGTGCCAACTCATGCTAACCTCGAGGTTAGCATGAGTTGGCACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)