EMAIL THIS PAGE TO A FRIEND

JUNB

jun B proto-oncogene

65 Gene Product Result for
Synonyms: AP-1
UniProtKB ID: P17275, Q96GH3
Gene ID:
Mouse(16477) Jun-B oncogene
Rat(24517) jun B proto-oncogene
dog(484927) jun B proto-oncogene
domestic cat(101085606) jun B proto-oncogene
cow(514246) jun B proto-oncogene
sheep(101123209) jun B proto-oncogene
sheep(443117) jun B proto-oncogene
domestic guinea pig(100716068) jun B proto-oncogene
naked mole-rat(101713599) jun B proto-oncogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
J3080 Anti-JUNB (261-275) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
J2955 Anti-JUNB (6-20) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300311 Anti-JUNB (Ab-259) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300310 Anti-JUNB (Ab-79) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry pricing
AV38135 Anti-JUNB (AB1) antibody produced in rabbit IgG fraction of antiserum dog, human, horse
immunohistochemistry, western blot pricing
AV100946 Anti-JUNB (AB2) antibody produced in rabbit IgG fraction of antiserum rat, dog, human, mouse, bovine, guinea pig
western blot pricing
AV100947 Anti-JUNB (AB3) antibody produced in rabbit IgG fraction of antiserum bovine, human, dog, guinea pig, mouse, rat, sheep
western blot pricing
AV38136 Anti-JUNB (AB4) antibody produced in rabbit affinity isolated antibody guinea pig, mouse, human, horse, sheep, bovine, dog, rat
western blot pricing
SAB2501262 Anti-JUNB antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
SAB1406056 Anti-JUNB antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
J106 Anti-JunB antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse
western blot pricing
HPA019149 Anti-JUNB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4501613 Anti-JUNB antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501614 Anti-JUNB antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4504456 Anti-phospho-JunB (pSer259) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300017 Anti-phospho-JUNB (pSer259) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4300016 Anti-phospho-JUNB (pSer79) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008416 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008416 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008416 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002229 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002229 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002229 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002229 Rosetta Predictions human pricing
NM_021836 Rosetta Predictions rat pricing
NM_008416 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204771 predicted 1242
2 SASI_Hs01_00204774 predicted 1122
3 SASI_Hs01_00204768 predicted 1078
4 SASI_Hs01_00204769 predicted 290
5 SASI_Hs01_00204770 predicted 347
6 SASI_Hs01_00204772 predicted 305
7 SASI_Hs01_00204773 predicted 1068
8 SASI_Hs01_00204775 predicted 1059
9 SASI_Hs01_00204776 predicted 348
10 SASI_Hs01_00204777 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021836 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073256 predicted 968
2 SASI_Rn01_00073257 predicted 1061
3 SASI_Rn01_00073258 predicted 384
4 SASI_Rn01_00073259 predicted 481
5 SASI_Rn01_00073260 predicted 1061
6 SASI_Rn02_00262837 predicted 901
7 SASI_Rn01_00073261 predicted 341
8 SASI_Rn01_00073262 predicted 772
9 SASI_Rn01_00073263 predicted 1101
10 SASI_Rn01_00073264 predicted 386
11 SASI_Rn01_00073265 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103237 predicted 1240
2 SASI_Mm01_00103243 predicted 1285
3 SASI_Mm02_00313865 predicted 1301
4 SASI_Mm02_00313866 predicted 609
5 SASI_Mm02_00313867 predicted 546
6 SASI_Mm01_00103234 predicted 1021
7 SASI_Mm01_00103235 predicted 1106
8 SASI_Mm01_00103236 predicted 535
9 SASI_Mm02_00313868 predicted 397
10 SASI_Mm02_00313869 predicted 533
11 SASI_Mm01_00103238 predicted 827
12 SASI_Mm01_00103239 predicted 953
13 SASI_Mm01_00103240 predicted 960
14 SASI_Mm01_00103241 predicted 371
15 SASI_Mm01_00103242 predicted 437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008416
VALIDATED
JUNB MISSION shRNA Bacterial Glycerol Stock
jun B proto-oncogene
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008416.1-399s21c1
Sequence:CCGGTGTCTCTACACGACTACAAACCTCGAGGTTTGTAGTCGTGTAGAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008416.1-1113s21c1
Sequence:CCGGGCATCAAAGTGGAGCGAAAGCCTCGAGGCTTTCGCTCCACTTTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008416.1-1009s21c1
Sequence:CCGGTCGTGGCGCTTCCGCCTTTAACTCGAGTTAAAGGCGGAAGCGCCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008416.1-739s21c1
Sequence:CCGGGGACGACCTGCACAAGATGAACTCGAGTTCATCTTGTGCAGGTCGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008416.1-415s1c1
Sequence:CCGGCAAACTCCTGAAACCCACCTTCTCGAGAAGGTGGGTTTCAGGAGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-1250s1c1
Sequence:CCGGGCCGGTCTCCTAAGGGAGCAACTCGAGTTGCTCCCTTAGGAGACCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-1110s1c1
Sequence:CCGGAGCGCATCAAAGTGGAGCGAACTCGAGTTCGCTCCACTTTGATGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008416.1-397s1c1
Sequence:CCGGCCTGTCTCTACACGACTACAACTCGAGTTGTAGTCGTGTAGAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-956s1c1
Sequence:CCGGCTCCCACATGCACCACCCTTTCTCGAGAAAGGGTGGTGCATGTGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-424s1c1
Sequence:CCGGGAAACCCACCTTGGCGCTCAACTCGAGTTGAGCGCCAAGGTGGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-1016s1c1
Sequence:CCGGGCTTCCGCCTTTAAAGAGGAACTCGAGTTCCTCTTTAAAGGCGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-1010s1c1
Sequence:CCGGCGTGGCGCTTCCGCCTTTAAACTCGAGTTTAAAGGCGGAAGCGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-1023s1c1
Sequence:CCGGCCTTTAAAGAGGAACCGCAGACTCGAGTCTGCGGTTCCTCTTTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008416.1-1598s21c1
Sequence:CCGGATTTGTGTATTTAACAGGGAGCTCGAGCTCCCTGTTAAATACACAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008416
VALIDATED
JUNB MISSION shRNA shRNA Plasmid DNA
jun B proto-oncogene
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008416.1-399s21c1
Sequence:CCGGTGTCTCTACACGACTACAAACCTCGAGGTTTGTAGTCGTGTAGAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008416.1-1113s21c1
Sequence:CCGGGCATCAAAGTGGAGCGAAAGCCTCGAGGCTTTCGCTCCACTTTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008416.1-1009s21c1
Sequence:CCGGTCGTGGCGCTTCCGCCTTTAACTCGAGTTAAAGGCGGAAGCGCCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008416.1-739s21c1
Sequence:CCGGGGACGACCTGCACAAGATGAACTCGAGTTCATCTTGTGCAGGTCGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008416.1-415s1c1
Sequence:CCGGCAAACTCCTGAAACCCACCTTCTCGAGAAGGTGGGTTTCAGGAGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-1250s1c1
Sequence:CCGGGCCGGTCTCCTAAGGGAGCAACTCGAGTTGCTCCCTTAGGAGACCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-1110s1c1
Sequence:CCGGAGCGCATCAAAGTGGAGCGAACTCGAGTTCGCTCCACTTTGATGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008416.1-397s1c1
Sequence:CCGGCCTGTCTCTACACGACTACAACTCGAGTTGTAGTCGTGTAGAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-956s1c1
Sequence:CCGGCTCCCACATGCACCACCCTTTCTCGAGAAAGGGTGGTGCATGTGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-424s1c1
Sequence:CCGGGAAACCCACCTTGGCGCTCAACTCGAGTTGAGCGCCAAGGTGGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-1016s1c1
Sequence:CCGGGCTTCCGCCTTTAAAGAGGAACTCGAGTTCCTCTTTAAAGGCGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-1010s1c1
Sequence:CCGGCGTGGCGCTTCCGCCTTTAAACTCGAGTTTAAAGGCGGAAGCGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-1023s1c1
Sequence:CCGGCCTTTAAAGAGGAACCGCAGACTCGAGTCTGCGGTTCCTCTTTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008416.1-1598s21c1
Sequence:CCGGATTTGTGTATTTAACAGGGAGCTCGAGCTCCCTGTTAAATACACAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008416
VALIDATED
JUNB MISSION shRNA Lentiviral Transduction Particles
jun B proto-oncogene
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008416.1-399s21c1
Sequence:CCGGTGTCTCTACACGACTACAAACCTCGAGGTTTGTAGTCGTGTAGAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008416.1-1113s21c1
Sequence:CCGGGCATCAAAGTGGAGCGAAAGCCTCGAGGCTTTCGCTCCACTTTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008416.1-1009s21c1
Sequence:CCGGTCGTGGCGCTTCCGCCTTTAACTCGAGTTAAAGGCGGAAGCGCCACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008416.1-739s21c1
Sequence:CCGGGGACGACCTGCACAAGATGAACTCGAGTTCATCTTGTGCAGGTCGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008416.1-415s1c1
Sequence:CCGGCAAACTCCTGAAACCCACCTTCTCGAGAAGGTGGGTTTCAGGAGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-1250s1c1
Sequence:CCGGGCCGGTCTCCTAAGGGAGCAACTCGAGTTGCTCCCTTAGGAGACCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-1110s1c1
Sequence:CCGGAGCGCATCAAAGTGGAGCGAACTCGAGTTCGCTCCACTTTGATGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008416.1-397s1c1
Sequence:CCGGCCTGTCTCTACACGACTACAACTCGAGTTGTAGTCGTGTAGAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-956s1c1
Sequence:CCGGCTCCCACATGCACCACCCTTTCTCGAGAAAGGGTGGTGCATGTGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-424s1c1
Sequence:CCGGGAAACCCACCTTGGCGCTCAACTCGAGTTGAGCGCCAAGGTGGGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-1016s1c1
Sequence:CCGGGCTTCCGCCTTTAAAGAGGAACTCGAGTTCCTCTTTAAAGGCGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-1010s1c1
Sequence:CCGGCGTGGCGCTTCCGCCTTTAAACTCGAGTTTAAAGGCGGAAGCGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008416.1-1023s1c1
Sequence:CCGGCCTTTAAAGAGGAACCGCAGACTCGAGTCTGCGGTTCCTCTTTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008416.1-1598s21c1
Sequence:CCGGATTTGTGTATTTAACAGGGAGCTCGAGCTCCCTGTTAAATACACAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002229
VALIDATED
JUNB MISSION shRNA Bacterial Glycerol Stock
jun B proto-oncogene
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002229.2-316s21c1
Sequence:CCGGTCATACACAGCTACGGGATACCTCGAGGTATCCCGTAGCTGTGTATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002229.2-365s21c1
Sequence:CCGGACGACTACAAACTCCTGAAACCTCGAGGTTTCAGGAGTTTGTAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002229.2-1536s21c1
Sequence:CCGGGGAAACAGACTCGATTCATATCTCGAGATATGAATCGAGTCTGTTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002229.2-1066s21c1
Sequence:CCGGGAAGACCAAGAGCGCATCAAACTCGAGTTTGATGCGCTCTTGGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002229.2-1054s1c1
Sequence:CCGGCCCATCAACATGGAAGACCAACTCGAGTTGGTCTTCCATGTTGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002229.2-1066s1c1
Sequence:CCGGGAAGACCAAGAGCGCATCAAACTCGAGTTTGATGCGCTCTTGGTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002229.2-355s1c1
Sequence:CCGGCTCTCTCTACACGACTACAAACTCGAGTTTGTAGTCGTGTAGAGAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002229.2-364s1c1
Sequence:CCGGCACGACTACAAACTCCTGAAACTCGAGTTTCAGGAGTTTGTAGTCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002229
VALIDATED
JUNB MISSION shRNA shRNA Plasmid DNA
jun B proto-oncogene
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002229.2-316s21c1
Sequence:CCGGTCATACACAGCTACGGGATACCTCGAGGTATCCCGTAGCTGTGTATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002229.2-365s21c1
Sequence:CCGGACGACTACAAACTCCTGAAACCTCGAGGTTTCAGGAGTTTGTAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002229.2-1536s21c1
Sequence:CCGGGGAAACAGACTCGATTCATATCTCGAGATATGAATCGAGTCTGTTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002229.2-1066s21c1
Sequence:CCGGGAAGACCAAGAGCGCATCAAACTCGAGTTTGATGCGCTCTTGGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002229.2-1054s1c1
Sequence:CCGGCCCATCAACATGGAAGACCAACTCGAGTTGGTCTTCCATGTTGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002229.2-1066s1c1
Sequence:CCGGGAAGACCAAGAGCGCATCAAACTCGAGTTTGATGCGCTCTTGGTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002229.2-355s1c1
Sequence:CCGGCTCTCTCTACACGACTACAAACTCGAGTTTGTAGTCGTGTAGAGAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002229.2-364s1c1
Sequence:CCGGCACGACTACAAACTCCTGAAACTCGAGTTTCAGGAGTTTGTAGTCGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002229
VALIDATED
JUNB MISSION shRNA Lentiviral Transduction Particles
jun B proto-oncogene
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002229.2-316s21c1
Sequence:CCGGTCATACACAGCTACGGGATACCTCGAGGTATCCCGTAGCTGTGTATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002229.2-365s21c1
Sequence:CCGGACGACTACAAACTCCTGAAACCTCGAGGTTTCAGGAGTTTGTAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002229.2-1536s21c1
Sequence:CCGGGGAAACAGACTCGATTCATATCTCGAGATATGAATCGAGTCTGTTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002229.2-1066s21c1
Sequence:CCGGGAAGACCAAGAGCGCATCAAACTCGAGTTTGATGCGCTCTTGGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002229.2-1054s1c1
Sequence:CCGGCCCATCAACATGGAAGACCAACTCGAGTTGGTCTTCCATGTTGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002229.2-1066s1c1
Sequence:CCGGGAAGACCAAGAGCGCATCAAACTCGAGTTTGATGCGCTCTTGGTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002229.2-355s1c1
Sequence:CCGGCTCTCTCTACACGACTACAAACTCGAGTTTGTAGTCGTGTAGAGAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002229.2-364s1c1
Sequence:CCGGCACGACTACAAACTCCTGAAACTCGAGTTTCAGGAGTTTGTAGTCGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)