EMAIL THIS PAGE TO A FRIEND

JUND

jun D proto-oncogene

93 Gene Product Result for
Synonyms: AP-1
UniProtKB ID: P17535, Q53EK9
Gene ID:
Human(3727) Summary: The protein encoded by this intronless gene is a member of the JUN family, and a functional component of the AP1 transcription factor complex. It has been proposed to protect cells from p53-dependent senescence and apoptosis. Alternate translation initiation site usage results in the production of different isoforms. [provided by RefSeq, Jul 2008]
Mouse(16478) Jun proto-oncogene related gene d
Rat(24518) jun D proto-oncogene
Zebrafish(564873) jun D proto-oncogene
cow(517192) jun D proto-oncogene
dog(609409) jun D proto-oncogene
domestic guinea pig(100734608) jun D proto-oncogene
sheep(443102) jun D proto-oncogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005354 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010592 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010592 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010592 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005354 siRNAs that have been validated in the lab human pricing
NM_138875 Rosetta Predictions rat pricing
XM_001070425 Rosetta Predictions rat pricing
NM_010592 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005354 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200236 validated 1005
2 SASI_Hs01_00200237 predicted 1074
3 SASI_Hs01_00200240 predicted 984
4 SASI_Hs01_00200242 predicted 1040
5 SASI_Hs01_00200245 predicted 978
6 SASI_Hs02_00339440 predicted 1016
7 SASI_Hs01_00200238 predicted 1011
8 SASI_Hs01_00200239 predicted 1006
9 SASI_Hs01_00200241 predicted 1009
10 SASI_Hs01_00200243 predicted 1095
11 SASI_Hs01_00200244 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138875 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120819 predicted 1039
2 SASI_Rn01_00120820 predicted 560
3 SASI_Rn01_00120821 predicted 936
4 SASI_Rn01_00120823 predicted 1043
5 SASI_Rn02_00268299 predicted 562
6 SASI_Rn01_00120824 predicted 1022
7 SASI_Rn01_00120825 predicted 562
8 SASI_Rn01_00120826 predicted 965
9 SASI_Rn01_00120827 predicted 1076
10 SASI_Rn01_00120828 predicted 954
11 SASI_Rn01_00120822 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070425 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331625 predicted 603
2 SASI_Rn02_00331626 predicted 500
3 SASI_Rn02_00331627 predicted 600
4 SASI_Rn02_00331628 predicted 580
5 SASI_Rn02_00331629 predicted 524
6 SASI_Rn02_00331630 predicted 643
7 SASI_Rn02_00331631 predicted 514
8 SASI_Rn02_00331632 predicted 504
9 SASI_Rn02_00331633 predicted 425
10 SASI_Rn02_00331634 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010592 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318898 predicted 2256
2 SASI_Mm01_00184444 predicted 1676
3 SASI_Mm01_00184443 predicted 1591
4 SASI_Mm02_00318899 predicted 1520
5 SASI_Mm02_00318900 predicted 1583
6 SASI_Mm02_00318901 predicted 1585
7 SASI_Mm02_00318902 predicted 1518
8 SASI_Mm02_00318903 predicted 1642
9 SASI_Mm02_00318904 predicted 1573
10 SASI_Mm01_00184449 predicted 1681
11 SASI_Mm01_00184445 predicted 382
12 SASI_Mm01_00184446 predicted 872
13 SASI_Mm01_00184447 predicted 720
14 SASI_Mm01_00184448 predicted 464
15 SASI_Mm01_00184450 predicted 512
16 SASI_Mm01_00184451 predicted 872
17 SASI_Mm01_00184452 predicted 942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005354
JUND MISSION shRNA Bacterial Glycerol Stock
jun D proto-oncogene
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005354.4-1047s21c1
Sequence:CCGGCAAGAGTCAGAACACGGAGCTCTCGAGAGCTCCGTGTTCTGACTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005354.4-493s21c1
Sequence:CCGGACGAGCTCACAGTTCCTCTACCTCGAGGTAGAGGAACTGTGAGCTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005354.2-1164s1c1
Sequence:CCGGCCACGTCAACAGCGGCTGCCACTCGAGTGGCAGCCGCTGTTGACGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005354.2-1056s1c1
Sequence:CCGGGCGCCTGGAAGAGAAAGTGAACTCGAGTTCACTTTCTCTTCCAGGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005354.2-321s1c1
Sequence:CCGGGCTGACGCTGAGCCTGAGTGACTCGAGTCACTCAGGCTCAGCGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005354.2-605s1c1
Sequence:CCGGTGGAGGATTTACACAAGCAGACTCGAGTCTGCTTGTGTAAATCCTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005354.2-1552s1c1
Sequence:CCGGCGCACGTCAAACCCTGCCTTTCTCGAGAAAGGCAGGGTTTGACGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005354.4-1116s21c1
Sequence:CCGGGAAAGTCCTCAGCCACGTCAACTCGAGTTGACGTGGCTGAGGACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005354.4-1582s21c1
Sequence:CCGGGAAGAACAGAGTGTTCGATTCCTCGAGGAATCGAACACTCTGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005354.4-269s21c1
Sequence:CCGGTGATGAAGAAGGACGCGCTGACTCGAGTCAGCGCGTCCTTCTTCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005354
JUND MISSION shRNA shRNA Plasmid DNA
jun D proto-oncogene
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005354.4-1047s21c1
Sequence:CCGGCAAGAGTCAGAACACGGAGCTCTCGAGAGCTCCGTGTTCTGACTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005354.4-493s21c1
Sequence:CCGGACGAGCTCACAGTTCCTCTACCTCGAGGTAGAGGAACTGTGAGCTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005354.2-1164s1c1
Sequence:CCGGCCACGTCAACAGCGGCTGCCACTCGAGTGGCAGCCGCTGTTGACGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005354.2-1056s1c1
Sequence:CCGGGCGCCTGGAAGAGAAAGTGAACTCGAGTTCACTTTCTCTTCCAGGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005354.2-321s1c1
Sequence:CCGGGCTGACGCTGAGCCTGAGTGACTCGAGTCACTCAGGCTCAGCGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005354.2-605s1c1
Sequence:CCGGTGGAGGATTTACACAAGCAGACTCGAGTCTGCTTGTGTAAATCCTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005354.2-1552s1c1
Sequence:CCGGCGCACGTCAAACCCTGCCTTTCTCGAGAAAGGCAGGGTTTGACGTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005354.4-1116s21c1
Sequence:CCGGGAAAGTCCTCAGCCACGTCAACTCGAGTTGACGTGGCTGAGGACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005354.4-1582s21c1
Sequence:CCGGGAAGAACAGAGTGTTCGATTCCTCGAGGAATCGAACACTCTGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005354.4-269s21c1
Sequence:CCGGTGATGAAGAAGGACGCGCTGACTCGAGTCAGCGCGTCCTTCTTCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005354
JUND MISSION shRNA Lentiviral Transduction Particles
jun D proto-oncogene
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005354.4-1047s21c1
Sequence:CCGGCAAGAGTCAGAACACGGAGCTCTCGAGAGCTCCGTGTTCTGACTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005354.4-493s21c1
Sequence:CCGGACGAGCTCACAGTTCCTCTACCTCGAGGTAGAGGAACTGTGAGCTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005354.2-1164s1c1
Sequence:CCGGCCACGTCAACAGCGGCTGCCACTCGAGTGGCAGCCGCTGTTGACGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005354.2-1056s1c1
Sequence:CCGGGCGCCTGGAAGAGAAAGTGAACTCGAGTTCACTTTCTCTTCCAGGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005354.2-321s1c1
Sequence:CCGGGCTGACGCTGAGCCTGAGTGACTCGAGTCACTCAGGCTCAGCGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005354.2-605s1c1
Sequence:CCGGTGGAGGATTTACACAAGCAGACTCGAGTCTGCTTGTGTAAATCCTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005354.2-1552s1c1
Sequence:CCGGCGCACGTCAAACCCTGCCTTTCTCGAGAAAGGCAGGGTTTGACGTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005354.4-1116s21c1
Sequence:CCGGGAAAGTCCTCAGCCACGTCAACTCGAGTTGACGTGGCTGAGGACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005354.4-1582s21c1
Sequence:CCGGGAAGAACAGAGTGTTCGATTCCTCGAGGAATCGAACACTCTGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005354.4-269s21c1
Sequence:CCGGTGATGAAGAAGGACGCGCTGACTCGAGTCAGCGCGTCCTTCTTCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010592
VALIDATED
JUND MISSION shRNA Bacterial Glycerol Stock
jun D proto-oncogene
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-972s1c1
Sequence:CCGGGCGCCTGGAGGAGAAAGTCAACTCGAGTTGACTTTCTCCTCCAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-240s1c1
Sequence:CCGGCCCGACGAGCAGCATGCTGAACTCGAGTTCAGCATGCTGCTCGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010592.3-1056s1c1
Sequence:CCGGGCAGCTCAAACAGAAAGTCCTCTCGAGAGGACTTTCTGTTTGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-982s1c1
Sequence:CCGGGAGAAAGTCAAGACCCTCAAACTCGAGTTTGAGGGTCTTGACTTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010592.3-868s1c1
Sequence:CCGGCCCATCGACATGGACACGCAACTCGAGTTGCGTGTCCATGTCGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-420s1c1
Sequence:CCGGGAGGCTGATCATCCAGTCCAACTCGAGTTGGACTGGATGATCAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-513s1c1
Sequence:CCGGGTTCGCCGAAGGCTTCGTCAACTCGAGTTGACGAAGCCTTCGGCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-377s1c1
Sequence:CCGGCGCCGGATCTTGGGCTGCTCACTCGAGTGAGCAGCCCAAGATCCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010592.3-657s1c1
Sequence:CCGGCTACGCCAACCTGAGCAGTTTCTCGAGAAACTGCTCAGGTTGGCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-378s1c1
Sequence:CCGGGCCGGATCTTGGGCTGCTCAACTCGAGTTGAGCAGCCCAAGATCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010592.4-1724s21c1
Sequence:CCGGGTTCGCCGAAGGCTTCGTCAACTCGAGTTGACGAAGCCTTCGGCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010592.4-2193s21c1
Sequence:CCGGGAGAAAGTCAAGACCCTCAAACTCGAGTTTGAGGGTCTTGACTTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010592.4-2183s21c1
Sequence:CCGGGCGCCTGGAGGAGAAAGTCAACTCGAGTTGACTTTCTCCTCCAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010592.4-2267s21c1
Sequence:CCGGGCAGCTCAAACAGAAAGTCCTCTCGAGAGGACTTTCTGTTTGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010592
VALIDATED
JUND MISSION shRNA shRNA Plasmid DNA
jun D proto-oncogene
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-972s1c1
Sequence:CCGGGCGCCTGGAGGAGAAAGTCAACTCGAGTTGACTTTCTCCTCCAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-240s1c1
Sequence:CCGGCCCGACGAGCAGCATGCTGAACTCGAGTTCAGCATGCTGCTCGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010592.3-1056s1c1
Sequence:CCGGGCAGCTCAAACAGAAAGTCCTCTCGAGAGGACTTTCTGTTTGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-982s1c1
Sequence:CCGGGAGAAAGTCAAGACCCTCAAACTCGAGTTTGAGGGTCTTGACTTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010592.3-868s1c1
Sequence:CCGGCCCATCGACATGGACACGCAACTCGAGTTGCGTGTCCATGTCGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-420s1c1
Sequence:CCGGGAGGCTGATCATCCAGTCCAACTCGAGTTGGACTGGATGATCAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-513s1c1
Sequence:CCGGGTTCGCCGAAGGCTTCGTCAACTCGAGTTGACGAAGCCTTCGGCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-377s1c1
Sequence:CCGGCGCCGGATCTTGGGCTGCTCACTCGAGTGAGCAGCCCAAGATCCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010592.3-657s1c1
Sequence:CCGGCTACGCCAACCTGAGCAGTTTCTCGAGAAACTGCTCAGGTTGGCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-378s1c1
Sequence:CCGGGCCGGATCTTGGGCTGCTCAACTCGAGTTGAGCAGCCCAAGATCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010592.4-1724s21c1
Sequence:CCGGGTTCGCCGAAGGCTTCGTCAACTCGAGTTGACGAAGCCTTCGGCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010592.4-2193s21c1
Sequence:CCGGGAGAAAGTCAAGACCCTCAAACTCGAGTTTGAGGGTCTTGACTTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010592.4-2183s21c1
Sequence:CCGGGCGCCTGGAGGAGAAAGTCAACTCGAGTTGACTTTCTCCTCCAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010592.4-2267s21c1
Sequence:CCGGGCAGCTCAAACAGAAAGTCCTCTCGAGAGGACTTTCTGTTTGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010592
VALIDATED
JUND MISSION shRNA Lentiviral Transduction Particles
jun D proto-oncogene
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-972s1c1
Sequence:CCGGGCGCCTGGAGGAGAAAGTCAACTCGAGTTGACTTTCTCCTCCAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-240s1c1
Sequence:CCGGCCCGACGAGCAGCATGCTGAACTCGAGTTCAGCATGCTGCTCGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010592.3-1056s1c1
Sequence:CCGGGCAGCTCAAACAGAAAGTCCTCTCGAGAGGACTTTCTGTTTGAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-982s1c1
Sequence:CCGGGAGAAAGTCAAGACCCTCAAACTCGAGTTTGAGGGTCTTGACTTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010592.3-868s1c1
Sequence:CCGGCCCATCGACATGGACACGCAACTCGAGTTGCGTGTCCATGTCGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-420s1c1
Sequence:CCGGGAGGCTGATCATCCAGTCCAACTCGAGTTGGACTGGATGATCAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-513s1c1
Sequence:CCGGGTTCGCCGAAGGCTTCGTCAACTCGAGTTGACGAAGCCTTCGGCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-377s1c1
Sequence:CCGGCGCCGGATCTTGGGCTGCTCACTCGAGTGAGCAGCCCAAGATCCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010592.3-657s1c1
Sequence:CCGGCTACGCCAACCTGAGCAGTTTCTCGAGAAACTGCTCAGGTTGGCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010592.3-378s1c1
Sequence:CCGGGCCGGATCTTGGGCTGCTCAACTCGAGTTGAGCAGCCCAAGATCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010592.4-1724s21c1
Sequence:CCGGGTTCGCCGAAGGCTTCGTCAACTCGAGTTGACGAAGCCTTCGGCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010592.4-2193s21c1
Sequence:CCGGGAGAAAGTCAAGACCCTCAAACTCGAGTTTGAGGGTCTTGACTTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010592.4-2183s21c1
Sequence:CCGGGCGCCTGGAGGAGAAAGTCAACTCGAGTTGACTTTCTCCTCCAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010592.4-2267s21c1
Sequence:CCGGGCAGCTCAAACAGAAAGTCCTCTCGAGAGGACTTTCTGTTTGAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)