EMAIL THIS PAGE TO A FRIEND

JUP

junction plakoglobin

107 Gene Product Result for
Synonyms: ARVD12 CTNNG DP3 DPIII PDGB PKGB
Gene ID:
Human(3728) Summary: This gene encodes a major cytoplasmic protein which is the only known constituent common to submembranous plaques of both desmosomes and intermediate junctions. This protein forms distinct complexes with cadherins and desmosomal cadherins and is a member of the catenin family since it contains a distinct repeating amino acid motif called the armadillo repeat. Mutation in this gene has been associated with Naxos disease. Alternative splicing occurs in this gene; however, not all transcripts have been fully described. [provided by RefSeq, Jul 2008]
Mouse(16480) junction plakoglobin
Rat(81679) junction plakoglobin
sheep(101119486) junction plakoglobin
Domestic Rabbit(100345709) junction plakoglobin
domestic guinea pig(100714103) junction plakoglobin
naked mole-rat(101705595) junction plakoglobin
chicken(429710) junction plakoglobin
dog(480522) junction plakoglobin
cow(445543) junction plakoglobin
domestic cat(101092310) junction plakoglobin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010593 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010593 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010593 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002230 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002230 siRNAs that have been validated in the lab human pricing
NM_021991 Rosetta Predictions human pricing
NM_031047 Rosetta Predictions rat pricing
NM_010593 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002230 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246520 validated 495
1 SASI_Hs01_00246522 validated 1530
1 SASI_Hs01_00246521 validated 1613
2 SASI_Hs01_00246523 predicted 598
3 SASI_Hs01_00246524 predicted 1074
4 SASI_Hs01_00246525 predicted 1105
5 SASI_Hs01_00246526 predicted 1540
6 SASI_Hs01_00246527 predicted 492
7 SASI_Hs01_00246528 predicted 1847
8 SASI_Hs01_00246529 predicted 1130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034570 predicted 493
2 SASI_Hs01_00034571 predicted 1616
3 SASI_Hs01_00034572 predicted 2582
4 SASI_Hs01_00034573 predicted 2597
5 SASI_Hs01_00034574 predicted 1524
6 SASI_Hs01_00034575 predicted 602
7 SASI_Hs01_00034576 predicted 1073
8 SASI_Hs01_00034577 predicted 1109
9 SASI_Hs02_00355358 predicted 2840
10 SASI_Hs01_00034578 predicted 1531
11 SASI_Hs01_00034579 predicted 1851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031047 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264273 predicted 542
2 SASI_Rn01_00073435 predicted 2744
3 SASI_Rn01_00073436 predicted 2845
4 SASI_Rn01_00073437 predicted 760
5 SASI_Rn01_00073438 predicted 838
6 SASI_Rn01_00073439 predicted 2841
7 SASI_Rn01_00073440 predicted 2443
8 SASI_Rn01_00073441 predicted 2358
9 SASI_Rn01_00073442 predicted 475
10 SASI_Rn01_00073443 predicted 450
11 SASI_Rn01_00073444 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010593 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171391 predicted 269
2 SASI_Mm01_00171392 predicted 2076
3 SASI_Mm01_00171393 predicted 2116
4 SASI_Mm01_00171394 predicted 560
5 SASI_Mm01_00171395 predicted 1296
6 SASI_Mm01_00171396 predicted 2157
7 SASI_Mm01_00171397 predicted 702
8 SASI_Mm01_00171398 predicted 1059
9 SASI_Mm01_00171399 predicted 1557
10 SASI_Mm01_00171400 predicted 1069
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010593
VALIDATED
JUP MISSION shRNA Bacterial Glycerol Stock
junction plakoglobin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010593.1-1598s21c1
Sequence:CCGGCCACTGGTCAAGGCAACTATTCTCGAGAATAGTTGCCTTGACCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010593.1-2365s21c1
Sequence:CCGGGCGCTGTTTCTCACCTGGAAACTCGAGTTTCCAGGTGAGAAACAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010593.1-943s21c1
Sequence:CCGGCAACAAGAACAACCCTAAGTTCTCGAGAACTTAGGGTTGTTCTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010593.1-1364s21c1
Sequence:CCGGCTGACCTGCAACAACAGCAAACTCGAGTTTGCTGTTGTTGCAGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010593.1-2365s1c1
Sequence:CCGGGCGCTGTTTCTCACCTGGAAACTCGAGTTTCCAGGTGAGAAACAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010593.1-826s1c1
Sequence:CCGGCGTAGAATCTGTCCTGTTCTACTCGAGTAGAACAGGACAGATTCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010593.1-1364s1c1
Sequence:CCGGCTGACCTGCAACAACAGCAAACTCGAGTTTGCTGTTGTTGCAGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010593.1-943s1c1
Sequence:CCGGCAACAAGAACAACCCTAAGTTCTCGAGAACTTAGGGTTGTTCTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010593.1-1598s1c1
Sequence:CCGGCCACTGGTCAAGGCAACTATTCTCGAGAATAGTTGCCTTGACCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010593
VALIDATED
JUP MISSION shRNA shRNA Plasmid DNA
junction plakoglobin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010593.1-1598s21c1
Sequence:CCGGCCACTGGTCAAGGCAACTATTCTCGAGAATAGTTGCCTTGACCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010593.1-2365s21c1
Sequence:CCGGGCGCTGTTTCTCACCTGGAAACTCGAGTTTCCAGGTGAGAAACAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010593.1-943s21c1
Sequence:CCGGCAACAAGAACAACCCTAAGTTCTCGAGAACTTAGGGTTGTTCTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010593.1-1364s21c1
Sequence:CCGGCTGACCTGCAACAACAGCAAACTCGAGTTTGCTGTTGTTGCAGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010593.1-2365s1c1
Sequence:CCGGGCGCTGTTTCTCACCTGGAAACTCGAGTTTCCAGGTGAGAAACAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010593.1-826s1c1
Sequence:CCGGCGTAGAATCTGTCCTGTTCTACTCGAGTAGAACAGGACAGATTCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010593.1-1364s1c1
Sequence:CCGGCTGACCTGCAACAACAGCAAACTCGAGTTTGCTGTTGTTGCAGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010593.1-943s1c1
Sequence:CCGGCAACAAGAACAACCCTAAGTTCTCGAGAACTTAGGGTTGTTCTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010593.1-1598s1c1
Sequence:CCGGCCACTGGTCAAGGCAACTATTCTCGAGAATAGTTGCCTTGACCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010593
VALIDATED
JUP MISSION shRNA Lentiviral Transduction Particles
junction plakoglobin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010593.1-1598s21c1
Sequence:CCGGCCACTGGTCAAGGCAACTATTCTCGAGAATAGTTGCCTTGACCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010593.1-2365s21c1
Sequence:CCGGGCGCTGTTTCTCACCTGGAAACTCGAGTTTCCAGGTGAGAAACAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010593.1-943s21c1
Sequence:CCGGCAACAAGAACAACCCTAAGTTCTCGAGAACTTAGGGTTGTTCTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010593.1-1364s21c1
Sequence:CCGGCTGACCTGCAACAACAGCAAACTCGAGTTTGCTGTTGTTGCAGGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010593.1-2365s1c1
Sequence:CCGGGCGCTGTTTCTCACCTGGAAACTCGAGTTTCCAGGTGAGAAACAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010593.1-826s1c1
Sequence:CCGGCGTAGAATCTGTCCTGTTCTACTCGAGTAGAACAGGACAGATTCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010593.1-1364s1c1
Sequence:CCGGCTGACCTGCAACAACAGCAAACTCGAGTTTGCTGTTGTTGCAGGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010593.1-943s1c1
Sequence:CCGGCAACAAGAACAACCCTAAGTTCTCGAGAACTTAGGGTTGTTCTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010593.1-1598s1c1
Sequence:CCGGCCACTGGTCAAGGCAACTATTCTCGAGAATAGTTGCCTTGACCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002230
JUP MISSION shRNA Bacterial Glycerol Stock
junction plakoglobin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002230.2-1084s21c1
Sequence:CCGGGATCATGCGTAACTACAGTTACTCGAGTAACTGTAGTTACGCATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002230.2-2528s21c1
Sequence:CCGGCCTGCCTTCTTCTTGTGTCTTCTCGAGAAGACACAAGAAGAAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002230.2-283s21c1
Sequence:CCGGGCGCCAGTACACGCTCAAGAACTCGAGTTCTTGAGCGTGTACTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002230.2-1147s21c1
Sequence:CCGGATCCGTGTGTCCCAGCAATAACTCGAGTTATTGCTGGGACACACGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002230.2-1554s21c1
Sequence:CCGGACTCTGTGCGTCTCAACTATGCTCGAGCATAGTTGAGACGCACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002230.1-1070s1c1
Sequence:CCGGGATCATGCGTAACTACAGTTACTCGAGTAACTGTAGTTACGCATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002230.1-2078s1c1
Sequence:CCGGCGAGGACAAGAACCCAGACTACTCGAGTAGTCTGGGTTCTTGTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002230.1-1293s1c1
Sequence:CCGGGTGCTGAAGATTCTGGTGAATCTCGAGATTCACCAGAATCTTCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002230.1-269s1c1
Sequence:CCGGGCGCCAGTACACGCTCAAGAACTCGAGTTCTTGAGCGTGTACTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002230.1-2515s1c1
Sequence:CCGGCCTGCCTTCTTCTTGTGTCTTCTCGAGAAGACACAAGAAGAAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002230
JUP MISSION shRNA shRNA Plasmid DNA
junction plakoglobin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002230.2-1084s21c1
Sequence:CCGGGATCATGCGTAACTACAGTTACTCGAGTAACTGTAGTTACGCATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002230.2-2528s21c1
Sequence:CCGGCCTGCCTTCTTCTTGTGTCTTCTCGAGAAGACACAAGAAGAAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002230.2-283s21c1
Sequence:CCGGGCGCCAGTACACGCTCAAGAACTCGAGTTCTTGAGCGTGTACTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002230.2-1147s21c1
Sequence:CCGGATCCGTGTGTCCCAGCAATAACTCGAGTTATTGCTGGGACACACGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002230.2-1554s21c1
Sequence:CCGGACTCTGTGCGTCTCAACTATGCTCGAGCATAGTTGAGACGCACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002230.1-1070s1c1
Sequence:CCGGGATCATGCGTAACTACAGTTACTCGAGTAACTGTAGTTACGCATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002230.1-2078s1c1
Sequence:CCGGCGAGGACAAGAACCCAGACTACTCGAGTAGTCTGGGTTCTTGTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002230.1-1293s1c1
Sequence:CCGGGTGCTGAAGATTCTGGTGAATCTCGAGATTCACCAGAATCTTCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002230.1-269s1c1
Sequence:CCGGGCGCCAGTACACGCTCAAGAACTCGAGTTCTTGAGCGTGTACTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002230.1-2515s1c1
Sequence:CCGGCCTGCCTTCTTCTTGTGTCTTCTCGAGAAGACACAAGAAGAAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002230
JUP MISSION shRNA Lentiviral Transduction Particles
junction plakoglobin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002230.2-1084s21c1
Sequence:CCGGGATCATGCGTAACTACAGTTACTCGAGTAACTGTAGTTACGCATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002230.2-2528s21c1
Sequence:CCGGCCTGCCTTCTTCTTGTGTCTTCTCGAGAAGACACAAGAAGAAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002230.2-283s21c1
Sequence:CCGGGCGCCAGTACACGCTCAAGAACTCGAGTTCTTGAGCGTGTACTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002230.2-1147s21c1
Sequence:CCGGATCCGTGTGTCCCAGCAATAACTCGAGTTATTGCTGGGACACACGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002230.2-1554s21c1
Sequence:CCGGACTCTGTGCGTCTCAACTATGCTCGAGCATAGTTGAGACGCACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002230.1-1070s1c1
Sequence:CCGGGATCATGCGTAACTACAGTTACTCGAGTAACTGTAGTTACGCATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002230.1-2078s1c1
Sequence:CCGGCGAGGACAAGAACCCAGACTACTCGAGTAGTCTGGGTTCTTGTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002230.1-1293s1c1
Sequence:CCGGGTGCTGAAGATTCTGGTGAATCTCGAGATTCACCAGAATCTTCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002230.1-269s1c1
Sequence:CCGGGCGCCAGTACACGCTCAAGAACTCGAGTTCTTGAGCGTGTACTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002230.1-2515s1c1
Sequence:CCGGCCTGCCTTCTTCTTGTGTCTTCTCGAGAAGACACAAGAAGAAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)