EMAIL THIS PAGE TO A FRIEND

KAAG1

kidney associated antigen 1

17 Gene Product Result for
Synonyms: RU2AS
Species: Human KAAG1(353219)
UniProtKB ID: Q9UBP8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181337 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025971 MISSION® esiRNA esiRNA human KAAG1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181337 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233381 predicted 936
2 SASI_Hs01_00233382 predicted 966
3 SASI_Hs01_00233383 predicted 932
4 SASI_Hs01_00233384 predicted 990
5 SASI_Hs01_00233385 predicted 960
6 SASI_Hs01_00233386 predicted 780
7 SASI_Hs01_00233387 predicted 992
8 SASI_Hs01_00233388 predicted 988
9 SASI_Hs01_00233389 predicted 922
10 SASI_Hs01_00233390 predicted 934
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181337
KAAG1 MISSION shRNA Bacterial Glycerol Stock
kidney associated antigen 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181337.2-945s1c1
Sequence:CCGGCCTGAAACGAACGAGAAACTGCTCGAGCAGTTTCTCGTTCGTTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181337.2-963s1c1
Sequence:CCGGCTGACGAATCCACAGGTGAAACTCGAGTTTCACCTGTGGATTCGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181337.2-1231s1c1
Sequence:CCGGCACACACACACACACAAATATCTCGAGATATTTGTGTGTGTGTGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181337.2-968s1c1
Sequence:CCGGGAATCCACAGGTGAAAGAGAACTCGAGTTCTCTTTCACCTGTGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181337.2-1227s1c1
Sequence:CCGGCACACACACACACACACACAACTCGAGTTGTGTGTGTGTGTGTGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181337.2-956s1c1
Sequence:CCGGCGAGAAACTGACGAATCCACACTCGAGTGTGGATTCGTCAGTTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181337.3-783s21c1
Sequence:CCGGGTACACAAGCACGCTCTTCACCTCGAGGTGAAGAGCGTGCTTGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181337.3-1043s21c1
Sequence:CCGGACTCGGAGTAGACGCTCAAGTCTCGAGACTTGAGCGTCTACTCCGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181337.3-1123s21c1
Sequence:CCGGACCTGCTACGGGCAGAATCAACTCGAGTTGATTCTGCCCGTAGCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181337
KAAG1 MISSION shRNA shRNA Plasmid DNA
kidney associated antigen 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181337.2-945s1c1
Sequence:CCGGCCTGAAACGAACGAGAAACTGCTCGAGCAGTTTCTCGTTCGTTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181337.2-963s1c1
Sequence:CCGGCTGACGAATCCACAGGTGAAACTCGAGTTTCACCTGTGGATTCGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181337.2-1231s1c1
Sequence:CCGGCACACACACACACACAAATATCTCGAGATATTTGTGTGTGTGTGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181337.2-968s1c1
Sequence:CCGGGAATCCACAGGTGAAAGAGAACTCGAGTTCTCTTTCACCTGTGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181337.2-1227s1c1
Sequence:CCGGCACACACACACACACACACAACTCGAGTTGTGTGTGTGTGTGTGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181337.2-956s1c1
Sequence:CCGGCGAGAAACTGACGAATCCACACTCGAGTGTGGATTCGTCAGTTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181337.3-783s21c1
Sequence:CCGGGTACACAAGCACGCTCTTCACCTCGAGGTGAAGAGCGTGCTTGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181337.3-1043s21c1
Sequence:CCGGACTCGGAGTAGACGCTCAAGTCTCGAGACTTGAGCGTCTACTCCGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181337.3-1123s21c1
Sequence:CCGGACCTGCTACGGGCAGAATCAACTCGAGTTGATTCTGCCCGTAGCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181337
KAAG1 MISSION shRNA Lentiviral Transduction Particles
kidney associated antigen 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181337.2-945s1c1
Sequence:CCGGCCTGAAACGAACGAGAAACTGCTCGAGCAGTTTCTCGTTCGTTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181337.2-963s1c1
Sequence:CCGGCTGACGAATCCACAGGTGAAACTCGAGTTTCACCTGTGGATTCGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181337.2-1231s1c1
Sequence:CCGGCACACACACACACACAAATATCTCGAGATATTTGTGTGTGTGTGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181337.2-968s1c1
Sequence:CCGGGAATCCACAGGTGAAAGAGAACTCGAGTTCTCTTTCACCTGTGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181337.2-1227s1c1
Sequence:CCGGCACACACACACACACACACAACTCGAGTTGTGTGTGTGTGTGTGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181337.2-956s1c1
Sequence:CCGGCGAGAAACTGACGAATCCACACTCGAGTGTGGATTCGTCAGTTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181337.3-783s21c1
Sequence:CCGGGTACACAAGCACGCTCTTCACCTCGAGGTGAAGAGCGTGCTTGTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181337.3-1043s21c1
Sequence:CCGGACTCGGAGTAGACGCTCAAGTCTCGAGACTTGAGCGTCTACTCCGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181337.3-1123s21c1
Sequence:CCGGACCTGCTACGGGCAGAATCAACTCGAGTTGATTCTGCCCGTAGCAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)