EMAIL THIS PAGE TO A FRIEND

KALRN

kalirin, RhoGEF kinase

484 Gene Product Result for
Synonyms: ARHGEF24 CHD5 CHDS5 DUET DUO HAPIP TRAD
Gene ID:
Human(8997) Summary: Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(545156) kalirin, RhoGEF kinase
Rat(84009) kalirin, RhoGEF kinase
chicken(424253) kalirin, RhoGEF kinase
dog(478592) kalirin, RhoGEF kinase
Horse(100060560) kalirin, RhoGEF kinase
cow(540675) kalirin, RhoGEF kinase
domestic cat(101094783) kalirin, RhoGEF kinase
domestic guinea pig(100726364) kalirin, RhoGEF kinase
naked mole-rat(101699733) kalirin, RhoGEF kinase
sheep(101120630) kalirin, RhoGEF kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007064 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007064 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007064 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_003947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003947 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024660 Rosetta Predictions human pricing
NM_003947 Rosetta Predictions human pricing
NM_007064 Rosetta Predictions human pricing
NM_032062 Rosetta Predictions rat pricing
XM_001001454 Rosetta Predictions mouse pricing
XM_001001845 Rosetta Predictions mouse pricing
XM_001481028 Rosetta Predictions mouse pricing
XM_001481029 Rosetta Predictions mouse pricing
XM_622639 Rosetta Predictions mouse pricing
XM_894473 Rosetta Predictions mouse pricing
XM_901574 Rosetta Predictions mouse pricing
XM_901576 Rosetta Predictions mouse pricing
XM_901579 Rosetta Predictions mouse pricing
XM_901583 Rosetta Predictions mouse pricing
XM_901586 Rosetta Predictions mouse pricing
XM_915058 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205231 predicted 6612
2 SASI_Hs01_00205233 predicted 9026
3 SASI_Hs01_00205234 predicted 6183
4 SASI_Hs01_00205235 predicted 6810
5 SASI_Hs01_00205236 predicted 8347
6 SASI_Hs01_00205237 predicted 6201
7 SASI_Hs02_00307218 predicted 5648
8 SASI_Hs01_00205238 predicted 8750
9 SASI_Hs01_00205239 predicted 6667
10 SASI_Hs01_00205240 predicted 6035
11 SASI_Hs01_00205232 predicted 8920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336605 predicted 4072
2 SASI_Hs02_00336606 predicted 4274
3 SASI_Hs02_00336607 predicted 3918
4 SASI_Hs01_00186817 predicted 4232
5 SASI_Hs01_00186818 predicted 3563
6 SASI_Hs01_00186819 predicted 2166
7 SASI_Hs02_00336608 predicted 3465
8 SASI_Hs01_00186821 predicted 3941
9 SASI_Hs01_00186822 predicted 1020
10 SASI_Hs01_00186823 predicted 4204
11 SASI_Hs01_00186820 predicted 2561
12 SASI_Hs01_00186824 predicted 3704
13 SASI_Hs01_00186825 predicted 3149
14 SASI_Hs01_00186826 predicted 2720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165051 predicted 1568
2 SASI_Hs01_00165053 predicted 3975
3 SASI_Hs01_00165054 predicted 1126
4 SASI_Hs01_00165055 predicted 1757
5 SASI_Hs01_00165056 predicted 3295
6 SASI_Hs01_00165057 predicted 1153
7 SASI_Hs02_00342878 predicted 601
8 SASI_Hs01_00165058 predicted 3691
9 SASI_Hs01_00165059 predicted 1613
10 SASI_Hs01_00165060 predicted 986
11 SASI_Hs01_00165052 predicted 3868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032062 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078315 predicted 7237
2 SASI_Rn01_00078316 predicted 7998
3 SASI_Rn02_00265417 predicted 6522
4 SASI_Rn01_00078317 predicted 2851
5 SASI_Rn01_00078318 predicted 6902
6 SASI_Rn01_00078319 predicted 5713
7 SASI_Rn02_00265418 predicted 857
8 SASI_Rn01_00078320 predicted 3739
9 SASI_Rn01_00078322 predicted 3362
10 SASI_Rn02_00265419 predicted 6509
11 SASI_Rn01_00078321 predicted 6531
12 SASI_Rn01_00078323 predicted 6462
13 SASI_Rn01_00078324 predicted 4750
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00355143 predicted 4449
2 SASI_Mm02_00355144 predicted 7399
3 SASI_Mm02_00355145 predicted 7774
4 SASI_Mm02_00355146 predicted 6671
5 SASI_Mm02_00355147 predicted 928
6 SASI_Mm02_00355148 predicted 7009
7 SASI_Mm02_00355149 predicted 8636
8 SASI_Mm02_00355150 predicted 1187
9 SASI_Mm02_00355151 predicted 4138
10 SASI_Mm02_00355152 predicted 4393
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001845 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268994 predicted 4831
2 SASI_Mm01_00268995 predicted 4040
3 SASI_Mm01_00268996 predicted 1823
4 SASI_Mm01_00268997 predicted 949
5 SASI_Mm01_00268998 predicted 4054
6 SASI_Mm01_00269000 predicted 1208
7 SASI_Mm01_00269001 predicted 4523
8 SASI_Mm01_00269003 predicted 4779
9 SASI_Mm02_00355293 predicted 4867
10 SASI_Mm02_00355294 predicted 4591
11 SASI_Mm01_00268999 predicted 3932
12 SASI_Mm01_00269002 predicted 3908
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00421489 predicted 4019
2 SASI_Mm02_00421490 predicted 1822
3 SASI_Mm02_00421491 predicted 948
4 SASI_Mm02_00421492 predicted 1993
5 SASI_Mm02_00421493 predicted 4026
6 SASI_Mm02_00421494 predicted 1207
7 SASI_Mm02_00421495 predicted 4497
8 SASI_Mm02_00421496 predicted 3869
9 SASI_Mm02_00421497 predicted 4561
10 SASI_Mm02_00421498 predicted 3702
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00421499 predicted 4037
2 SASI_Mm02_00421500 predicted 1822
3 SASI_Mm02_00421501 predicted 955
4 SASI_Mm02_00421502 predicted 1989
5 SASI_Mm02_00421503 predicted 4052
6 SASI_Mm02_00421504 predicted 1213
7 SASI_Mm02_00421505 predicted 4523
8 SASI_Mm02_00421506 predicted 3902
9 SASI_Mm02_00421507 predicted 4595
10 SASI_Mm02_00421508 predicted 3721
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_622639 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220169 predicted 2047
2 SASI_Mm01_00220170 predicted 1047
3 SASI_Mm01_00220171 predicted 1449
4 SASI_Mm01_00220172 predicted 1991
5 SASI_Mm01_00220173 predicted 440
6 SASI_Mm01_00220174 predicted 1965
7 SASI_Mm01_00220175 predicted 841
8 SASI_Mm01_00220176 predicted 1309
9 SASI_Mm01_00220177 predicted 833
10 SASI_Mm01_00220178 predicted 2080
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274058 predicted 4795
2 SASI_Mm01_00274059 predicted 4019
3 SASI_Mm01_00274060 predicted 1827
4 SASI_Mm01_00274061 predicted 955
5 SASI_Mm01_00274062 predicted 4025
6 SASI_Mm01_00274064 predicted 1207
7 SASI_Mm01_00274065 predicted 4491
8 SASI_Mm01_00274067 predicted 4752
9 SASI_Mm02_00429466 predicted 4839
10 SASI_Mm02_00429467 predicted 4566
11 SASI_Mm01_00274063 predicted 3900
12 SASI_Mm01_00274066 predicted 3881
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901574 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280888 predicted 3110
2 SASI_Mm01_00280889 predicted 2504
3 SASI_Mm01_00280890 predicted 3083
4 SASI_Mm01_00280891 predicted 2827
5 SASI_Mm01_00280892 predicted 1940
6 SASI_Mm01_00280893 predicted 2716
7 SASI_Mm01_00280894 predicted 2639
8 SASI_Mm01_00280895 predicted 2375
9 SASI_Mm01_00280896 predicted 2794
10 SASI_Mm01_00280897 predicted 2718
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901576 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229155 predicted 1788
2 SASI_Mm01_00229156 predicted 3399
3 SASI_Mm01_00229157 predicted 1005
4 SASI_Mm01_00229158 predicted 3977
5 SASI_Mm01_00229159 predicted 3727
6 SASI_Mm01_00229160 predicted 1016
7 SASI_Mm01_00229161 predicted 884
8 SASI_Mm01_00229162 predicted 1480
9 SASI_Mm01_00229163 predicted 3603
10 SASI_Mm01_00229164 predicted 3538
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901579 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249133 predicted 716
2 SASI_Mm01_00249134 predicted 931
3 SASI_Mm01_00249135 predicted 709
4 SASI_Mm01_00249136 predicted 905
5 SASI_Mm01_00249137 predicted 845
6 SASI_Mm01_00249138 predicted 446
7 SASI_Mm01_00249139 predicted 893
8 SASI_Mm01_00249140 predicted 1010
9 SASI_Mm01_00249141 predicted 967
10 SASI_Mm01_00249142 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210558 predicted 3279
2 SASI_Mm01_00210559 predicted 2495
3 SASI_Mm01_00210560 predicted 1452
4 SASI_Mm01_00210561 predicted 2502
5 SASI_Mm01_00210562 predicted 2366
6 SASI_Mm01_00210563 predicted 2966
7 SASI_Mm01_00210564 predicted 2351
8 SASI_Mm01_00210565 predicted 3218
9 SASI_Mm01_00210566 predicted 3319
10 SASI_Mm01_00210567 predicted 3042
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280506 predicted 3154
2 SASI_Mm01_00280507 predicted 2371
3 SASI_Mm01_00280508 predicted 1332
4 SASI_Mm01_00280509 predicted 2384
5 SASI_Mm01_00280510 predicted 2254
6 SASI_Mm01_00280511 predicted 2851
7 SASI_Mm01_00280512 predicted 2230
8 SASI_Mm01_00280513 predicted 3098
9 SASI_Mm01_00280514 predicted 3191
10 SASI_Mm01_00280515 predicted 2925
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915058 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262084 predicted 2718
2 SASI_Mm01_00262085 predicted 1411
3 SASI_Mm01_00262086 predicted 3091
4 SASI_Mm01_00262087 predicted 2898
5 SASI_Mm01_00262088 predicted 1991
6 SASI_Mm01_00262089 predicted 1742
7 SASI_Mm01_00262090 predicted 2333
8 SASI_Mm01_00262091 predicted 4065
9 SASI_Mm01_00262092 predicted 3959
10 SASI_Mm01_00262093 predicted 1616
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007064
KALRN MISSION shRNA Bacterial Glycerol Stock
kalirin, RhoGEF kinase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007064.1-2372s1c1
Sequence:CCGGGTGATGATCTTGACCCTAATACTCGAGTATTAGGGTCAAGATCATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007064.1-3421s1c1
Sequence:CCGGGTTGCACATTTGGACATAAAGCTCGAGCTTTATGTCCAAATGTGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007064.1-3941s1c1
Sequence:CCGGCCAATGTCAAGAGCTACATTGCTCGAGCAATGTAGCTCTTGACATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195291    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007064.1-5193s1c1
Sequence:CCGGCTGATAGTTCTCTGAACTAAACTCGAGTTTAGTTCAGAGAACTATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007064.x-1297s1c1
Sequence:CCGGGTGGAGTTAATGTGCCTTGTTCTCGAGAACAAGGCACATTAACTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007064.x-4597s1c1
Sequence:CCGGGCACAATTAGATGACAAGTTTCTCGAGAAACTTGTCATCTAATTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007064.x-3146s1c1
Sequence:CCGGGCAAAGATGTGGCTGTGAAATCTCGAGATTTCACAGCCACATCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007064.x-3696s1c1
Sequence:CCGGCAACGTATGCAGGGTGGATTTCTCGAGAAATCCACCCTGCATACGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007064.x-2013s1c1
Sequence:CCGGCAAAGATTACTATGCACTGAACTCGAGTTCAGTGCATAGTAATCTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007064
KALRN MISSION shRNA shRNA Plasmid DNA
kalirin, RhoGEF kinase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007064.1-2372s1c1
Sequence:CCGGGTGATGATCTTGACCCTAATACTCGAGTATTAGGGTCAAGATCATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007064.1-3421s1c1
Sequence:CCGGGTTGCACATTTGGACATAAAGCTCGAGCTTTATGTCCAAATGTGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007064.1-3941s1c1
Sequence:CCGGCCAATGTCAAGAGCTACATTGCTCGAGCAATGTAGCTCTTGACATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195291    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007064.1-5193s1c1
Sequence:CCGGCTGATAGTTCTCTGAACTAAACTCGAGTTTAGTTCAGAGAACTATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007064.x-1297s1c1
Sequence:CCGGGTGGAGTTAATGTGCCTTGTTCTCGAGAACAAGGCACATTAACTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007064.x-4597s1c1
Sequence:CCGGGCACAATTAGATGACAAGTTTCTCGAGAAACTTGTCATCTAATTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007064.x-3146s1c1
Sequence:CCGGGCAAAGATGTGGCTGTGAAATCTCGAGATTTCACAGCCACATCTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007064.x-3696s1c1
Sequence:CCGGCAACGTATGCAGGGTGGATTTCTCGAGAAATCCACCCTGCATACGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007064.x-2013s1c1
Sequence:CCGGCAAAGATTACTATGCACTGAACTCGAGTTCAGTGCATAGTAATCTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007064
KALRN MISSION shRNA Lentiviral Transduction Particles
kalirin, RhoGEF kinase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007064.1-2372s1c1
Sequence:CCGGGTGATGATCTTGACCCTAATACTCGAGTATTAGGGTCAAGATCATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007064.1-3421s1c1
Sequence:CCGGGTTGCACATTTGGACATAAAGCTCGAGCTTTATGTCCAAATGTGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007064.1-3941s1c1
Sequence:CCGGCCAATGTCAAGAGCTACATTGCTCGAGCAATGTAGCTCTTGACATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195291    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007064.1-5193s1c1
Sequence:CCGGCTGATAGTTCTCTGAACTAAACTCGAGTTTAGTTCAGAGAACTATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007064.x-1297s1c1
Sequence:CCGGGTGGAGTTAATGTGCCTTGTTCTCGAGAACAAGGCACATTAACTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007064.x-4597s1c1
Sequence:CCGGGCACAATTAGATGACAAGTTTCTCGAGAAACTTGTCATCTAATTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007064.x-3146s1c1
Sequence:CCGGGCAAAGATGTGGCTGTGAAATCTCGAGATTTCACAGCCACATCTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007064.x-3696s1c1
Sequence:CCGGCAACGTATGCAGGGTGGATTTCTCGAGAAATCCACCCTGCATACGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007064.x-2013s1c1
Sequence:CCGGCAAAGATTACTATGCACTGAACTCGAGTTCAGTGCATAGTAATCTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003947
VALIDATED
KALRN MISSION shRNA Bacterial Glycerol Stock
kalirin, RhoGEF kinase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_003947.1-3936s1c1
Sequence:CCGGCCCGGAAGAAAGAATTTATTACTCGAGTAATAAATTCTTTCTTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003947.1-4078s1c1
Sequence:CCGGGCATATCATCTTTGGCAACATCTCGAGATGTTGCCAAAGATGATATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003947.1-1859s1c1
Sequence:CCGGGCTCAGAATACGTACACCAATCTCGAGATTGGTGTACGTATTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003947.1-4340s1c1
Sequence:CCGGCCTGTCCAAAGGATCACCAAACTCGAGTTTGGTGATCCTTTGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003947.1-2558s1c1
Sequence:CCGGGCCATGAACAACATGACCTTTCTCGAGAAAGGTCATGTTGTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003947.3-4833s21c1
Sequence:CCGGTGATTCAAGAAAGGATCATTCCTCGAGGAATGATCCTTTCTTGAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003947.3-322s21c1
Sequence:CCGGGCGGAAACTCGTGACGTATTTCTCGAGAAATACGTCACGAGTTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003947.3-4641s21c1
Sequence:CCGGCTTCAGGACACACGAAATATGCTCGAGCATATTTCGTGTGTCCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003947.3-5455s21c1
Sequence:GTACCGGACATGAGTGAAGAGGTTAATTCTCGAGAATTAACCTCTTCACTCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003947.3-3838s21c1
Sequence:CCGGGGACCTGGAGCTGGATATTATCTCGAGATAATATCCAGCTCCAGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003947
VALIDATED
KALRN MISSION shRNA shRNA Plasmid DNA
kalirin, RhoGEF kinase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_003947.1-3936s1c1
Sequence:CCGGCCCGGAAGAAAGAATTTATTACTCGAGTAATAAATTCTTTCTTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003947.1-4078s1c1
Sequence:CCGGGCATATCATCTTTGGCAACATCTCGAGATGTTGCCAAAGATGATATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003947.1-1859s1c1
Sequence:CCGGGCTCAGAATACGTACACCAATCTCGAGATTGGTGTACGTATTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003947.1-4340s1c1
Sequence:CCGGCCTGTCCAAAGGATCACCAAACTCGAGTTTGGTGATCCTTTGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003947.1-2558s1c1
Sequence:CCGGGCCATGAACAACATGACCTTTCTCGAGAAAGGTCATGTTGTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003947.3-4833s21c1
Sequence:CCGGTGATTCAAGAAAGGATCATTCCTCGAGGAATGATCCTTTCTTGAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003947.3-322s21c1
Sequence:CCGGGCGGAAACTCGTGACGTATTTCTCGAGAAATACGTCACGAGTTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003947.3-4641s21c1
Sequence:CCGGCTTCAGGACACACGAAATATGCTCGAGCATATTTCGTGTGTCCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003947.3-5455s21c1
Sequence:GTACCGGACATGAGTGAAGAGGTTAATTCTCGAGAATTAACCTCTTCACTCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003947.3-3838s21c1
Sequence:CCGGGGACCTGGAGCTGGATATTATCTCGAGATAATATCCAGCTCCAGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003947
VALIDATED
KALRN MISSION shRNA Lentiviral Transduction Particles
kalirin, RhoGEF kinase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_003947.1-3936s1c1
Sequence:CCGGCCCGGAAGAAAGAATTTATTACTCGAGTAATAAATTCTTTCTTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003947.1-4078s1c1
Sequence:CCGGGCATATCATCTTTGGCAACATCTCGAGATGTTGCCAAAGATGATATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003947.1-1859s1c1
Sequence:CCGGGCTCAGAATACGTACACCAATCTCGAGATTGGTGTACGTATTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003947.1-4340s1c1
Sequence:CCGGCCTGTCCAAAGGATCACCAAACTCGAGTTTGGTGATCCTTTGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003947.1-2558s1c1
Sequence:CCGGGCCATGAACAACATGACCTTTCTCGAGAAAGGTCATGTTGTTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003947.3-4833s21c1
Sequence:CCGGTGATTCAAGAAAGGATCATTCCTCGAGGAATGATCCTTTCTTGAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003947.3-322s21c1
Sequence:CCGGGCGGAAACTCGTGACGTATTTCTCGAGAAATACGTCACGAGTTTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003947.3-4641s21c1
Sequence:CCGGCTTCAGGACACACGAAATATGCTCGAGCATATTTCGTGTGTCCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003947.3-5455s21c1
Sequence:GTACCGGACATGAGTGAAGAGGTTAATTCTCGAGAATTAACCTCTTCACTCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003947.3-3838s21c1
Sequence:CCGGGGACCTGGAGCTGGATATTATCTCGAGATAATATCCAGCTCCAGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)