EMAIL THIS PAGE TO A FRIEND

KANK1

KN motif and ankyrin repeat domains 1

175 Gene Product Result for
Synonyms: ANKRD15 CPSQ2 KANK
UniProtKB ID: Q14678, A2A2W8, D3DRH3, Q5W0W0, Q8IY65, Q8WX74
Gene ID:
Human(23189) Summary: The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseuodgene has been identified on chromosome 20. [provided by RefSeq, Mar 2012]
Mouse(107351) KN motif and ankyrin repeat domains 1
Rat(309429) KN motif and ankyrin repeat domains 1
Zebrafish(777729) KN motif and ankyrin repeat domains 1
cow(534869) KN motif and ankyrin repeat domains 1
Horse(100050757) KN motif and ankyrin repeat domains 1
domestic cat(101101346) KN motif and ankyrin repeat domains 1
dog(100687276) KN motif and ankyrin repeat domains 1
chicken(395475) KN motif and ankyrin repeat domains 1
sheep(101109511) KN motif and ankyrin repeat domains 1
domestic guinea pig(100727320) KN motif and ankyrin repeat domains 1
naked mole-rat(101702127) KN motif and ankyrin repeat domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181404 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181404 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181404 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015158 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015158 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015158 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015158 Rosetta Predictions human pricing
NM_153186 Rosetta Predictions human pricing
NM_001037197 Rosetta Predictions rat pricing
XM_001055725 Rosetta Predictions rat pricing
XM_001080106 Rosetta Predictions rat pricing
NM_181404 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138435 predicted 4253
2 SASI_Hs01_00138436 predicted 3800
3 SASI_Hs01_00138437 predicted 1538
4 SASI_Hs01_00138439 predicted 1185
5 SASI_Hs01_00138440 predicted 1826
6 SASI_Hs01_00138441 predicted 2277
7 SASI_Hs02_00347122 predicted 2723
8 SASI_Hs01_00138442 predicted 2985
9 SASI_Hs02_00347123 predicted 4064
10 SASI_Hs02_00347124 predicted 2658
11 SASI_Hs01_00138434 predicted 1521
12 SASI_Hs01_00138438 predicted 2420
13 SASI_Hs01_00138443 predicted 1863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074514 predicted 4437
2 SASI_Hs01_00074515 predicted 3982
3 SASI_Hs01_00074516 predicted 1725
4 SASI_Hs01_00074518 predicted 1363
5 SASI_Hs01_00074519 predicted 2000
6 SASI_Hs01_00074520 predicted 2451
7 SASI_Hs02_00367028 predicted 2901
8 SASI_Hs01_00074521 predicted 3169
9 SASI_Hs02_00367029 predicted 4247
10 SASI_Hs02_00367030 predicted 2837
11 SASI_Hs01_00074513 predicted 1694
12 SASI_Hs01_00074517 predicted 2599
13 SASI_Hs01_00074522 predicted 2042
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204296 predicted 2091
2 SASI_Rn02_00204297 predicted 1571
3 SASI_Rn02_00204298 predicted 3055
4 SASI_Rn02_00204299 predicted 4131
5 SASI_Rn02_00204300 predicted 1563
6 SASI_Rn02_00204301 predicted 1879
7 SASI_Rn02_00204302 predicted 2476
8 SASI_Rn02_00204303 predicted 1401
9 SASI_Rn02_00204304 predicted 815
10 SASI_Rn02_00204305 predicted 3990
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055725 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280754 predicted 2331
2 SASI_Rn02_00280755 predicted 1803
3 SASI_Rn02_00280756 predicted 3289
4 SASI_Rn02_00280757 predicted 4359
5 SASI_Rn02_00280758 predicted 1795
6 SASI_Rn02_00280759 predicted 2107
7 SASI_Rn02_00280760 predicted 2709
8 SASI_Rn02_00280761 predicted 1636
9 SASI_Rn02_00280762 predicted 1049
10 SASI_Rn02_00280763 predicted 4225
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366628 predicted 2083
2 SASI_Rn02_00366629 predicted 1560
3 SASI_Rn02_00366630 predicted 3042
4 SASI_Rn02_00366631 predicted 4119
5 SASI_Rn02_00366632 predicted 1557
6 SASI_Rn02_00366633 predicted 1864
7 SASI_Rn02_00366634 predicted 2466
8 SASI_Rn02_00366635 predicted 1398
9 SASI_Rn02_00366636 predicted 808
10 SASI_Rn02_00366637 predicted 3985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056635 predicted 1811
2 SASI_Mm02_00349751 predicted 2320
3 SASI_Mm01_00056636 predicted 4379
4 SASI_Mm01_00056637 predicted 1135
5 SASI_Mm01_00056639 predicted 2028
6 SASI_Mm01_00056640 predicted 3716
7 SASI_Mm01_00056641 predicted 1028
8 SASI_Mm01_00056642 predicted 3661
9 SASI_Mm01_00056643 predicted 3451
10 SASI_Mm01_00056644 predicted 2120
11 SASI_Mm01_00056638 predicted 3106
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181404
VALIDATED
KANK1 MISSION shRNA Bacterial Glycerol Stock
KN motif and ankyrin repeat domains 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181404.5-1653s21c1
Sequence:CCGGCATGAACGATGTCGTTGTATACTCGAGTATACAACGACATCGTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181404.5-4996s21c1
Sequence:CCGGGCTGATAATTTCCCGCTTAAACTCGAGTTTAAGCGGGAAATTATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181404.3-826s1c1
Sequence:CCGGGTCGTCCATCAATTCCGTCATCTCGAGATGACGGAATTGATGGACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181404.3-1218s1c1
Sequence:CCGGGCGGGTATGAACTAAGTGAAACTCGAGTTTCACTTAGTTCATACCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181404.3-909s1c1
Sequence:CCGGCTACAGGAAATCACTTGGAATCTCGAGATTCCAAGTGATTTCCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181404.3-1105s1c1
Sequence:CCGGCCTCTACGTATGTCCAAATAACTCGAGTTATTTGGACATACGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181404.3-1426s1c1
Sequence:CCGGGCTCCGGTACATCATCAACATCTCGAGATGTTGATGATGTACCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181404
VALIDATED
KANK1 MISSION shRNA shRNA Plasmid DNA
KN motif and ankyrin repeat domains 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181404.5-1653s21c1
Sequence:CCGGCATGAACGATGTCGTTGTATACTCGAGTATACAACGACATCGTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181404.5-4996s21c1
Sequence:CCGGGCTGATAATTTCCCGCTTAAACTCGAGTTTAAGCGGGAAATTATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181404.3-826s1c1
Sequence:CCGGGTCGTCCATCAATTCCGTCATCTCGAGATGACGGAATTGATGGACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181404.3-1218s1c1
Sequence:CCGGGCGGGTATGAACTAAGTGAAACTCGAGTTTCACTTAGTTCATACCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181404.3-909s1c1
Sequence:CCGGCTACAGGAAATCACTTGGAATCTCGAGATTCCAAGTGATTTCCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181404.3-1105s1c1
Sequence:CCGGCCTCTACGTATGTCCAAATAACTCGAGTTATTTGGACATACGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181404.3-1426s1c1
Sequence:CCGGGCTCCGGTACATCATCAACATCTCGAGATGTTGATGATGTACCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181404
VALIDATED
KANK1 MISSION shRNA Lentiviral Transduction Particles
KN motif and ankyrin repeat domains 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181404.5-1653s21c1
Sequence:CCGGCATGAACGATGTCGTTGTATACTCGAGTATACAACGACATCGTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181404.5-4996s21c1
Sequence:CCGGGCTGATAATTTCCCGCTTAAACTCGAGTTTAAGCGGGAAATTATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181404.3-826s1c1
Sequence:CCGGGTCGTCCATCAATTCCGTCATCTCGAGATGACGGAATTGATGGACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181404.3-1218s1c1
Sequence:CCGGGCGGGTATGAACTAAGTGAAACTCGAGTTTCACTTAGTTCATACCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181404.3-909s1c1
Sequence:CCGGCTACAGGAAATCACTTGGAATCTCGAGATTCCAAGTGATTTCCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181404.3-1105s1c1
Sequence:CCGGCCTCTACGTATGTCCAAATAACTCGAGTTATTTGGACATACGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181404.3-1426s1c1
Sequence:CCGGGCTCCGGTACATCATCAACATCTCGAGATGTTGATGATGTACCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015158
VALIDATED
KANK1 MISSION shRNA Bacterial Glycerol Stock
KN motif and ankyrin repeat domains 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015158.2-2734s21c1
Sequence:CCGGATCAGCACCCTGTCGTCTATCCTCGAGGATAGACGACAGGGTGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015158.2-259s21c1
Sequence:CCGGGACTTAGATTTCCTCAAATATCTCGAGATATTTGAGGAAATCTAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015158.2-3647s21c1
Sequence:CCGGCCCACTCCAACTTCGAGATTGCTCGAGCAATCTCGAAGTTGGAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015158.1-720s1c1
Sequence:CCGGCAGAATGGATACCAAGGTAATCTCGAGATTACCTTGGTATCCATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015158.1-944s1c1
Sequence:CCGGCCAGGTAAAGATCTCTGTCTTCTCGAGAAGACAGAGATCTTTACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015158.1-3118s1c1
Sequence:CCGGGCTCAGATGAAAGCTCTTCTTCTCGAGAAGAAGAGCTTTCATCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015158.1-1460s1c1
Sequence:CCGGGCAGACCATAGAATCCTTGAACTCGAGTTCAAGGATTCTATGGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015158.2-371s21c1
Sequence:CCGGCATCTGGTCAGCAAGGTATATCTCGAGATATACCTTGCTGACCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015158.2-1577s21c1
Sequence:CCGGATGACCGGGAGATGACTAAACCTCGAGGTTTAGTCATCTCCCGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015158.2-4197s21c1
Sequence:CCGGGTATGCAAATAGCCCTTTATTCTCGAGAATAAAGGGCTATTTGCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015158.2-4262s21c1
Sequence:CCGGGATACTGAATGTATACGTATTCTCGAGAATACGTATACATTCAGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015158
VALIDATED
KANK1 MISSION shRNA shRNA Plasmid DNA
KN motif and ankyrin repeat domains 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015158.2-2734s21c1
Sequence:CCGGATCAGCACCCTGTCGTCTATCCTCGAGGATAGACGACAGGGTGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015158.2-259s21c1
Sequence:CCGGGACTTAGATTTCCTCAAATATCTCGAGATATTTGAGGAAATCTAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015158.2-3647s21c1
Sequence:CCGGCCCACTCCAACTTCGAGATTGCTCGAGCAATCTCGAAGTTGGAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015158.1-720s1c1
Sequence:CCGGCAGAATGGATACCAAGGTAATCTCGAGATTACCTTGGTATCCATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015158.1-944s1c1
Sequence:CCGGCCAGGTAAAGATCTCTGTCTTCTCGAGAAGACAGAGATCTTTACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015158.1-3118s1c1
Sequence:CCGGGCTCAGATGAAAGCTCTTCTTCTCGAGAAGAAGAGCTTTCATCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015158.1-1460s1c1
Sequence:CCGGGCAGACCATAGAATCCTTGAACTCGAGTTCAAGGATTCTATGGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015158.2-371s21c1
Sequence:CCGGCATCTGGTCAGCAAGGTATATCTCGAGATATACCTTGCTGACCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015158.2-1577s21c1
Sequence:CCGGATGACCGGGAGATGACTAAACCTCGAGGTTTAGTCATCTCCCGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015158.2-4197s21c1
Sequence:CCGGGTATGCAAATAGCCCTTTATTCTCGAGAATAAAGGGCTATTTGCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015158.2-4262s21c1
Sequence:CCGGGATACTGAATGTATACGTATTCTCGAGAATACGTATACATTCAGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015158
VALIDATED
KANK1 MISSION shRNA Lentiviral Transduction Particles
KN motif and ankyrin repeat domains 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015158.2-2734s21c1
Sequence:CCGGATCAGCACCCTGTCGTCTATCCTCGAGGATAGACGACAGGGTGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015158.2-259s21c1
Sequence:CCGGGACTTAGATTTCCTCAAATATCTCGAGATATTTGAGGAAATCTAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015158.2-3647s21c1
Sequence:CCGGCCCACTCCAACTTCGAGATTGCTCGAGCAATCTCGAAGTTGGAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015158.1-720s1c1
Sequence:CCGGCAGAATGGATACCAAGGTAATCTCGAGATTACCTTGGTATCCATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015158.1-944s1c1
Sequence:CCGGCCAGGTAAAGATCTCTGTCTTCTCGAGAAGACAGAGATCTTTACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015158.1-3118s1c1
Sequence:CCGGGCTCAGATGAAAGCTCTTCTTCTCGAGAAGAAGAGCTTTCATCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015158.1-1460s1c1
Sequence:CCGGGCAGACCATAGAATCCTTGAACTCGAGTTCAAGGATTCTATGGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015158.2-371s21c1
Sequence:CCGGCATCTGGTCAGCAAGGTATATCTCGAGATATACCTTGCTGACCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015158.2-1577s21c1
Sequence:CCGGATGACCGGGAGATGACTAAACCTCGAGGTTTAGTCATCTCCCGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015158.2-4197s21c1
Sequence:CCGGGTATGCAAATAGCCCTTTATTCTCGAGAATAAAGGGCTATTTGCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015158.2-4262s21c1
Sequence:CCGGGATACTGAATGTATACGTATTCTCGAGAATACGTATACATTCAGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)