EMAIL THIS PAGE TO A FRIEND

KANK2

KN motif and ankyrin repeat domains 2

79 Gene Product Result for
Synonyms: ANKRD25 MXRA3 SIP
Gene ID:
Mouse(235041) KN motif and ankyrin repeat domains 2
Rat(100361376) KN motif and ankyrin repeat domains 2
domestic guinea pig(100720189) KN motif and ankyrin repeat domains 2
naked mole-rat(101704660) KN motif and ankyrin repeat domains 2
sheep(101117071) KN motif and ankyrin repeat domains 2
Zebrafish(494584) KN motif and ankyrin repeat domains 2
cow(767586) KN motif and ankyrin repeat domains 2
domestic cat(101097546) KN motif and ankyrin repeat domains 2
dog(100682578) KN motif and ankyrin repeat domains 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145611 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145611 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145611 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015493 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015493 Rosetta Predictions human pricing
NM_145611 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234726 predicted 1755
2 SASI_Hs01_00234727 predicted 2774
3 SASI_Hs01_00234728 predicted 2069
4 SASI_Hs01_00234729 predicted 642
5 SASI_Hs01_00234730 predicted 1869
6 SASI_Hs01_00234731 predicted 2777
7 SASI_Hs01_00234732 predicted 1762
8 SASI_Hs01_00234733 predicted 1884
9 SASI_Hs01_00234734 predicted 1003
10 SASI_Hs01_00234735 predicted 2294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022645 predicted 2096
2 SASI_Mm02_00341178 predicted 2655
3 SASI_Mm01_00022646 predicted 1723
4 SASI_Mm01_00022647 predicted 1624
5 SASI_Mm01_00022648 predicted 1958
6 SASI_Mm01_00022649 predicted 2249
7 SASI_Mm01_00022650 predicted 1265
8 SASI_Mm01_00022651 predicted 1956
9 SASI_Mm01_00022652 predicted 1526
10 SASI_Mm01_00022653 predicted 1336
11 SASI_Mm01_00022654 predicted 1948
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145611
VALIDATED
KANK2 MISSION shRNA Bacterial Glycerol Stock
KN motif and ankyrin repeat domains 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145611.2-3100s1c1
Sequence:CCGGCCACCCTTTGTCACCTCATTTCTCGAGAAATGAGGTGACAAAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145611.2-1338s1c1
Sequence:CCGGGCATTACAGAACGGAGTTGCACTCGAGTGCAACTCCGTTCTGTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145611.2-1931s1c1
Sequence:CCGGCGAGAACTGAAAGTGGCCTATCTCGAGATAGGCCACTTTCAGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145611.2-1589s1c1
Sequence:CCGGCTCCAGTTTGTGGGAGTCAATCTCGAGATTGACTCCCACAAACTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145611.2-2548s1c1
Sequence:CCGGCGAGATCGCATCTATGCTGTACTCGAGTACAGCATAGATGCGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145611.4-2576s21c1
Sequence:CCGGCGAGATCGCATCTATGCTGTACTCGAGTACAGCATAGATGCGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145611.4-1959s21c1
Sequence:CCGGCGAGAACTGAAAGTGGCCTATCTCGAGATAGGCCACTTTCAGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145611.4-3128s21c1
Sequence:CCGGCCACCCTTTGTCACCTCATTTCTCGAGAAATGAGGTGACAAAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145611.4-1366s21c1
Sequence:CCGGGCATTACAGAACGGAGTTGCACTCGAGTGCAACTCCGTTCTGTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145611
VALIDATED
KANK2 MISSION shRNA shRNA Plasmid DNA
KN motif and ankyrin repeat domains 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145611.2-3100s1c1
Sequence:CCGGCCACCCTTTGTCACCTCATTTCTCGAGAAATGAGGTGACAAAGGGTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000085057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145611.2-1338s1c1
Sequence:CCGGGCATTACAGAACGGAGTTGCACTCGAGTGCAACTCCGTTCTGTAATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000085056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145611.2-1931s1c1
Sequence:CCGGCGAGAACTGAAAGTGGCCTATCTCGAGATAGGCCACTTTCAGTTCTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000085054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145611.2-1589s1c1
Sequence:CCGGCTCCAGTTTGTGGGAGTCAATCTCGAGATTGACTCCCACAAACTGGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000085055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145611.2-2548s1c1
Sequence:CCGGCGAGATCGCATCTATGCTGTACTCGAGTACAGCATAGATGCGATCTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000331792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145611.4-2576s21c1
Sequence:CCGGCGAGATCGCATCTATGCTGTACTCGAGTACAGCATAGATGCGATCTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000302031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145611.4-1959s21c1
Sequence:CCGGCGAGAACTGAAAGTGGCCTATCTCGAGATAGGCCACTTTCAGTTCTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000302094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145611.4-3128s21c1
Sequence:CCGGCCACCCTTTGTCACCTCATTTCTCGAGAAATGAGGTGACAAAGGGTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000302032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145611.4-1366s21c1
Sequence:CCGGGCATTACAGAACGGAGTTGCACTCGAGTGCAACTCCGTTCTGTAATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145611
VALIDATED
KANK2 MISSION shRNA Lentiviral Transduction Particles
KN motif and ankyrin repeat domains 2
Mouse
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000085053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145611.2-3100s1c1
Sequence:CCGGCCACCCTTTGTCACCTCATTTCTCGAGAAATGAGGTGACAAAGGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145611.2-1338s1c1
Sequence:CCGGGCATTACAGAACGGAGTTGCACTCGAGTGCAACTCCGTTCTGTAATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145611.2-1931s1c1
Sequence:CCGGCGAGAACTGAAAGTGGCCTATCTCGAGATAGGCCACTTTCAGTTCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145611.2-1589s1c1
Sequence:CCGGCTCCAGTTTGTGGGAGTCAATCTCGAGATTGACTCCCACAAACTGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145611.2-2548s1c1
Sequence:CCGGCGAGATCGCATCTATGCTGTACTCGAGTACAGCATAGATGCGATCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145611.4-2576s21c1
Sequence:CCGGCGAGATCGCATCTATGCTGTACTCGAGTACAGCATAGATGCGATCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145611.4-1959s21c1
Sequence:CCGGCGAGAACTGAAAGTGGCCTATCTCGAGATAGGCCACTTTCAGTTCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145611.4-3128s21c1
Sequence:CCGGCCACCCTTTGTCACCTCATTTCTCGAGAAATGAGGTGACAAAGGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145611.4-1366s21c1
Sequence:CCGGGCATTACAGAACGGAGTTGCACTCGAGTGCAACTCCGTTCTGTAATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015493
KANK2 MISSION shRNA Bacterial Glycerol Stock
KN motif and ankyrin repeat domains 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015493.6-2562s21c1
Sequence:CCGGAGATTGCGTCCATGCTGTATTCTCGAGAATACAGCATGGACGCAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015493.3-682s1c1
Sequence:CCGGCCTCAAGTACGTGGATGACATCTCGAGATGTCATCCACGTACTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015493.3-2725s1c1
Sequence:CCGGGCTTGGCAACATCAATGCCAACTCGAGTTGGCATTGATGTTGCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015493.3-3028s1c1
Sequence:CCGGCATGAACATCAAGTGCTCGTTCTCGAGAACGAGCACTTGATGTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015493.3-2834s1c1
Sequence:CCGGGATGTCAACGTGCAAGATGATCTCGAGATCATCTTGCACGTTGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015493.3-2831s1c1
Sequence:CCGGGCAGATGTCAACGTGCAAGATCTCGAGATCTTGCACGTTGACATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015493
KANK2 MISSION shRNA shRNA Plasmid DNA
KN motif and ankyrin repeat domains 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015493.6-2562s21c1
Sequence:CCGGAGATTGCGTCCATGCTGTATTCTCGAGAATACAGCATGGACGCAATCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000155948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015493.3-682s1c1
Sequence:CCGGCCTCAAGTACGTGGATGACATCTCGAGATGTCATCCACGTACTTGAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000155303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015493.3-2725s1c1
Sequence:CCGGGCTTGGCAACATCAATGCCAACTCGAGTTGGCATTGATGTTGCCAAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000153784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015493.3-3028s1c1
Sequence:CCGGCATGAACATCAAGTGCTCGTTCTCGAGAACGAGCACTTGATGTTCATGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000152599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015493.3-2834s1c1
Sequence:CCGGGATGTCAACGTGCAAGATGATCTCGAGATCATCTTGCACGTTGACATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000155100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015493.3-2831s1c1
Sequence:CCGGGCAGATGTCAACGTGCAAGATCTCGAGATCTTGCACGTTGACATCTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015493
KANK2 MISSION shRNA Lentiviral Transduction Particles
KN motif and ankyrin repeat domains 2
Human
6 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000423384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015493.6-2562s21c1
Sequence:CCGGAGATTGCGTCCATGCTGTATTCTCGAGAATACAGCATGGACGCAATCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015493.3-682s1c1
Sequence:CCGGCCTCAAGTACGTGGATGACATCTCGAGATGTCATCCACGTACTTGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015493.3-2725s1c1
Sequence:CCGGGCTTGGCAACATCAATGCCAACTCGAGTTGGCATTGATGTTGCCAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015493.3-3028s1c1
Sequence:CCGGCATGAACATCAAGTGCTCGTTCTCGAGAACGAGCACTTGATGTTCATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015493.3-2834s1c1
Sequence:CCGGGATGTCAACGTGCAAGATGATCTCGAGATCATCTTGCACGTTGACATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015493.3-2831s1c1
Sequence:CCGGGCAGATGTCAACGTGCAAGATCTCGAGATCTTGCACGTTGACATCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)