EMAIL THIS PAGE TO A FRIEND

KANK4

KN motif and ankyrin repeat domains 4

93 Gene Product Result for
Synonyms: ANKRD38 RP5-1155K23.5 dJ1078M7.1
UniProtKB ID: Q5T7N3, B1ALP7, Q6P9A0, Q86T71, Q86VE6, Q8NAX3
Gene ID:
Mouse(242553) KN motif and ankyrin repeat domains 4
Rat(313385) KN motif and ankyrin repeat domains 4
domestic guinea pig(100729968) KN motif and ankyrin repeat domains 4
naked mole-rat(101720735) KN motif and ankyrin repeat domains 4
sheep(101106979) KN motif and ankyrin repeat domains 4
chicken(424684) KN motif and ankyrin repeat domains 4
cow(519027) KN motif and ankyrin repeat domains 4
Horse(100070416) KN motif and ankyrin repeat domains 4
domestic cat(101099484) KN motif and ankyrin repeat domains 4
dog(100684819) KN motif and ankyrin repeat domains 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181712 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181712 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181712 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172872 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172872 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172872 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181712 Rosetta Predictions human pricing
NM_001107947 Rosetta Predictions rat pricing
NM_172872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370319 predicted 1988
2 SASI_Hs01_00098387 predicted 1652
3 SASI_Hs01_00098388 predicted 2044
4 SASI_Hs01_00098389 predicted 3265
5 SASI_Hs01_00098390 predicted 2481
6 SASI_Hs02_00370320 predicted 2913
7 SASI_Hs01_00098391 predicted 1256
8 SASI_Hs01_00098392 predicted 1667
9 SASI_Hs01_00098393 predicted 2612
10 SASI_Hs01_00098395 predicted 1862
11 SASI_Hs01_00098386 predicted 1839
12 SASI_Hs01_00098394 predicted 1526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107947 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233855 predicted 3206
2 SASI_Rn02_00233856 predicted 3196
3 SASI_Rn02_00233857 predicted 2440
4 SASI_Rn02_00233858 predicted 995
5 SASI_Rn02_00233859 predicted 893
6 SASI_Rn02_00233860 predicted 1255
7 SASI_Rn02_00233861 predicted 2327
8 SASI_Rn02_00233862 predicted 3210
9 SASI_Rn02_00233863 predicted 2657
10 SASI_Rn02_00233864 predicted 1947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182270 predicted 2460
2 SASI_Mm01_00182271 predicted 3326
3 SASI_Mm01_00182272 predicted 239
4 SASI_Mm01_00182273 predicted 3128
5 SASI_Mm01_00182274 predicted 2562
6 SASI_Mm01_00182275 predicted 2610
7 SASI_Mm01_00182277 predicted 3230
8 SASI_Mm01_00182278 predicted 1236
9 SASI_Mm01_00182279 predicted 1362
10 SASI_Mm02_00344843 predicted 2741
11 SASI_Mm01_00182276 predicted 2458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181712
KANK4 MISSION shRNA Bacterial Glycerol Stock
KN motif and ankyrin repeat domains 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181712.2-2604s1c1
Sequence:CCGGGAGAGATATAAACCCTCAGAACTCGAGTTCTGAGGGTTTATATCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150212    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181712.2-4295s1c1
Sequence:CCGGCCCTAGAAGCAAATATCTGTTCTCGAGAACAGATATTTGCTTCTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181712.2-3492s1c1
Sequence:CCGGGCACATACATTCCTGTTGTATCTCGAGATACAACAGGAATGTATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181712.2-1164s1c1
Sequence:CCGGGACAAGGAAGATGAACACAATCTCGAGATTGTGTTCATCTTCCTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181712.2-4249s1c1
Sequence:CCGGCGTATCCATTACCTCATGGTACTCGAGTACCATGAGGTAATGGATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181712.4-434s21c1
Sequence:CCGGTCCGAAGAGCCACCCTTATTCCTCGAGGAATAAGGGTGGCTCTTCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181712.4-2945s21c1
Sequence:CCGGAGCTGGCTACACTGCCGTAATCTCGAGATTACGGCAGTGTAGCCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181712
KANK4 MISSION shRNA shRNA Plasmid DNA
KN motif and ankyrin repeat domains 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181712.2-2604s1c1
Sequence:CCGGGAGAGATATAAACCCTCAGAACTCGAGTTCTGAGGGTTTATATCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150212    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181712.2-4295s1c1
Sequence:CCGGCCCTAGAAGCAAATATCTGTTCTCGAGAACAGATATTTGCTTCTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181712.2-3492s1c1
Sequence:CCGGGCACATACATTCCTGTTGTATCTCGAGATACAACAGGAATGTATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181712.2-1164s1c1
Sequence:CCGGGACAAGGAAGATGAACACAATCTCGAGATTGTGTTCATCTTCCTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181712.2-4249s1c1
Sequence:CCGGCGTATCCATTACCTCATGGTACTCGAGTACCATGAGGTAATGGATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181712.4-434s21c1
Sequence:CCGGTCCGAAGAGCCACCCTTATTCCTCGAGGAATAAGGGTGGCTCTTCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181712.4-2945s21c1
Sequence:CCGGAGCTGGCTACACTGCCGTAATCTCGAGATTACGGCAGTGTAGCCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181712
KANK4 MISSION shRNA Lentiviral Transduction Particles
KN motif and ankyrin repeat domains 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181712.2-2604s1c1
Sequence:CCGGGAGAGATATAAACCCTCAGAACTCGAGTTCTGAGGGTTTATATCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150212    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181712.2-4295s1c1
Sequence:CCGGCCCTAGAAGCAAATATCTGTTCTCGAGAACAGATATTTGCTTCTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181712.2-3492s1c1
Sequence:CCGGGCACATACATTCCTGTTGTATCTCGAGATACAACAGGAATGTATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181712.2-1164s1c1
Sequence:CCGGGACAAGGAAGATGAACACAATCTCGAGATTGTGTTCATCTTCCTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181712.2-4249s1c1
Sequence:CCGGCGTATCCATTACCTCATGGTACTCGAGTACCATGAGGTAATGGATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181712.4-434s21c1
Sequence:CCGGTCCGAAGAGCCACCCTTATTCCTCGAGGAATAAGGGTGGCTCTTCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181712.4-2945s21c1
Sequence:CCGGAGCTGGCTACACTGCCGTAATCTCGAGATTACGGCAGTGTAGCCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172872
KANK4 MISSION shRNA Bacterial Glycerol Stock
KN motif and ankyrin repeat domains 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172872.2-3351s1c1
Sequence:CCGGGCACAGTACATTCCCATCATACTCGAGTATGATGGGAATGTACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172872.2-310s1c1
Sequence:CCGGCCTCAAATATGTGGATGACATCTCGAGATGTCATCCACATATTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172872.2-2151s1c1
Sequence:CCGGCGACCAGCCTTAAATCCATAACTCGAGTTATGGATTTAAGGCTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172872.3-1350s21c1
Sequence:CCGGGAGTGCACTGTAGCCCATTTACTCGAGTAAATGGGCTACAGTGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172872.3-841s21c1
Sequence:CCGGGGGAACTAGAGCCAGCAATTCCTCGAGGAATTGCTGGCTCTAGTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172872.3-3615s21c1
Sequence:CCGGTCAAGTGTGTATACAAATATGCTCGAGCATATTTGTATACACACTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172872.3-1867s21c1
Sequence:CCGGATGCCACAATCGGGCAGTATGCTCGAGCATACTGCCCGATTGTGGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172872.3-358s21c1
Sequence:CCGGGAGCCAAGCAGGCTAAGTTTACTCGAGTAAACTTAGCCTGCTTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172872
KANK4 MISSION shRNA shRNA Plasmid DNA
KN motif and ankyrin repeat domains 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172872.2-3351s1c1
Sequence:CCGGGCACAGTACATTCCCATCATACTCGAGTATGATGGGAATGTACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172872.2-310s1c1
Sequence:CCGGCCTCAAATATGTGGATGACATCTCGAGATGTCATCCACATATTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172872.2-2151s1c1
Sequence:CCGGCGACCAGCCTTAAATCCATAACTCGAGTTATGGATTTAAGGCTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172872.3-1350s21c1
Sequence:CCGGGAGTGCACTGTAGCCCATTTACTCGAGTAAATGGGCTACAGTGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172872.3-841s21c1
Sequence:CCGGGGGAACTAGAGCCAGCAATTCCTCGAGGAATTGCTGGCTCTAGTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172872.3-3615s21c1
Sequence:CCGGTCAAGTGTGTATACAAATATGCTCGAGCATATTTGTATACACACTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172872.3-1867s21c1
Sequence:CCGGATGCCACAATCGGGCAGTATGCTCGAGCATACTGCCCGATTGTGGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172872.3-358s21c1
Sequence:CCGGGAGCCAAGCAGGCTAAGTTTACTCGAGTAAACTTAGCCTGCTTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172872
KANK4 MISSION shRNA Lentiviral Transduction Particles
KN motif and ankyrin repeat domains 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172872.2-3351s1c1
Sequence:CCGGGCACAGTACATTCCCATCATACTCGAGTATGATGGGAATGTACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172872.2-310s1c1
Sequence:CCGGCCTCAAATATGTGGATGACATCTCGAGATGTCATCCACATATTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172872.2-2151s1c1
Sequence:CCGGCGACCAGCCTTAAATCCATAACTCGAGTTATGGATTTAAGGCTGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172872.3-1350s21c1
Sequence:CCGGGAGTGCACTGTAGCCCATTTACTCGAGTAAATGGGCTACAGTGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172872.3-841s21c1
Sequence:CCGGGGGAACTAGAGCCAGCAATTCCTCGAGGAATTGCTGGCTCTAGTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172872.3-3615s21c1
Sequence:CCGGTCAAGTGTGTATACAAATATGCTCGAGCATATTTGTATACACACTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172872.3-1867s21c1
Sequence:CCGGATGCCACAATCGGGCAGTATGCTCGAGCATACTGCCCGATTGTGGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172872.3-358s21c1
Sequence:CCGGGAGCCAAGCAGGCTAAGTTTACTCGAGTAAACTTAGCCTGCTTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)