EMAIL THIS PAGE TO A FRIEND

KANSL1

KAT8 regulatory NSL complex subunit 1

210 Gene Product Result for
Synonyms: CENP-36 KDVS KIAA1267 MSL1v1 NSL1 hMSL1v1
Gene ID:
Human(284058) Summary: This gene encodes a nuclear protein that is a subunit of two protein complexes involved with histone acetylation, the MLL1 complex and the NSL1 complex. The corresponding protein in Drosophila interacts with K(lysine) acetyltransferase 8, which is also a subunit of both the MLL1 and NSL1 complexes. [provided by RefSeq, Jun 2012]
Mouse(76719) KAT8 regulatory NSL complex subunit 1
chicken(419961) KAT8 regulatory NSL complex subunit 1
dog(480489) KAT8 regulatory NSL complex subunit 1
cow(535946) KAT8 regulatory NSL complex subunit 1
domestic cat(101090973) KAT8 regulatory NSL complex subunit 1
sheep(101121022) KAT8 regulatory NSL complex subunit 1
domestic guinea pig(100713349) KAT8 regulatory NSL complex subunit 1
naked mole-rat(101718442) KAT8 regulatory NSL complex subunit 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015443 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081045 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081045 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081045 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015443 Rosetta Predictions human pricing
NM_001081045 Rosetta Predictions mouse pricing
XM_109700 Rosetta Predictions mouse pricing
XM_903072 Rosetta Predictions mouse pricing
XM_903075 Rosetta Predictions mouse pricing
XM_903076 Rosetta Predictions mouse pricing
XM_903078 Rosetta Predictions mouse pricing
XM_903080 Rosetta Predictions mouse pricing
XM_903081 Rosetta Predictions mouse pricing
XM_903082 Rosetta Predictions mouse pricing
XM_903083 Rosetta Predictions mouse pricing
XM_903084 Rosetta Predictions mouse pricing
XM_903086 Rosetta Predictions mouse pricing
XM_903087 Rosetta Predictions mouse pricing
XM_921865 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040777 predicted 432
2 SASI_Hs01_00040778 predicted 2722
3 SASI_Hs01_00040779 predicted 655
4 SASI_Hs01_00040780 predicted 1568
5 SASI_Hs01_00040781 predicted 2489
6 SASI_Hs01_00040782 predicted 734
7 SASI_Hs01_00040783 predicted 1541
8 SASI_Hs01_00040784 predicted 1559
9 SASI_Hs01_00040785 predicted 923
10 SASI_Hs01_00040786 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294631 predicted 995
2 SASI_Mm02_00294632 predicted 1470
3 SASI_Mm02_00294633 predicted 1552
4 SASI_Mm02_00294634 predicted 1260
5 SASI_Mm02_00294635 predicted 2273
6 SASI_Mm02_00294636 predicted 1396
7 SASI_Mm02_00294637 predicted 1063
8 SASI_Mm02_00294638 predicted 2813
9 SASI_Mm02_00294639 predicted 2770
10 SASI_Mm02_00294640 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_109700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217144 predicted 996
2 SASI_Mm01_00217145 predicted 1475
3 SASI_Mm01_00217146 predicted 1309
4 SASI_Mm01_00217147 predicted 1066
5 SASI_Mm01_00217148 predicted 1626
6 SASI_Mm01_00217149 predicted 1557
7 SASI_Mm01_00217150 predicted 1265
8 SASI_Mm01_00217151 predicted 1405
9 SASI_Mm01_00217152 predicted 1078
10 SASI_Mm01_00217153 predicted 1387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251100 predicted 1059
2 SASI_Mm01_00251101 predicted 1316
3 SASI_Mm01_00251102 predicted 1287
4 SASI_Mm01_00251103 predicted 1252
5 SASI_Mm01_00251104 predicted 1301
6 SASI_Mm01_00251105 predicted 1657
7 SASI_Mm01_00251106 predicted 1533
8 SASI_Mm01_00251107 predicted 1334
9 SASI_Mm01_00251108 predicted 1862
10 SASI_Mm01_00251109 predicted 1447
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903075 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205822 predicted 824
2 SASI_Mm01_00205823 predicted 1298
3 SASI_Mm01_00205824 predicted 1131
4 SASI_Mm01_00205825 predicted 880
5 SASI_Mm01_00205826 predicted 1455
6 SASI_Mm01_00205827 predicted 1384
7 SASI_Mm01_00205828 predicted 1087
8 SASI_Mm01_00205829 predicted 1227
9 SASI_Mm01_00205830 predicted 898
10 SASI_Mm01_00205831 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903076 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230893 predicted 594
2 SASI_Mm01_00230894 predicted 1074
3 SASI_Mm01_00230895 predicted 901
4 SASI_Mm01_00230896 predicted 656
5 SASI_Mm01_00230897 predicted 1228
6 SASI_Mm01_00230898 predicted 1148
7 SASI_Mm01_00230899 predicted 855
8 SASI_Mm01_00230900 predicted 993
9 SASI_Mm01_00230901 predicted 664
10 SASI_Mm01_00230902 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243022 predicted 518
2 SASI_Mm01_00243023 predicted 991
3 SASI_Mm01_00243024 predicted 824
4 SASI_Mm01_00243025 predicted 573
5 SASI_Mm01_00243026 predicted 1140
6 SASI_Mm01_00243027 predicted 1068
7 SASI_Mm01_00243028 predicted 786
8 SASI_Mm01_00243029 predicted 913
9 SASI_Mm01_00243030 predicted 590
10 SASI_Mm01_00243031 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209284 predicted 825
2 SASI_Mm01_00209285 predicted 1307
3 SASI_Mm01_00209286 predicted 1129
4 SASI_Mm01_00209287 predicted 888
5 SASI_Mm01_00209288 predicted 1452
6 SASI_Mm01_00209289 predicted 1384
7 SASI_Mm01_00209290 predicted 1090
8 SASI_Mm01_00209291 predicted 1223
9 SASI_Mm01_00209292 predicted 893
10 SASI_Mm01_00209293 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239833 predicted 828
2 SASI_Mm01_00239834 predicted 1298
3 SASI_Mm01_00239835 predicted 1125
4 SASI_Mm01_00239836 predicted 883
5 SASI_Mm01_00239837 predicted 1450
6 SASI_Mm01_00239838 predicted 1379
7 SASI_Mm01_00239839 predicted 1095
8 SASI_Mm01_00239840 predicted 1228
9 SASI_Mm01_00239841 predicted 900
10 SASI_Mm01_00239842 predicted 1215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903082 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216838 predicted 818
2 SASI_Mm01_00216839 predicted 1297
3 SASI_Mm01_00216840 predicted 1135
4 SASI_Mm01_00216841 predicted 880
5 SASI_Mm01_00216842 predicted 1451
6 SASI_Mm01_00216843 predicted 1387
7 SASI_Mm01_00216844 predicted 1088
8 SASI_Mm01_00216845 predicted 1222
9 SASI_Mm01_00216846 predicted 899
10 SASI_Mm01_00216847 predicted 1216
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903083 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252220 predicted 827
2 SASI_Mm01_00252221 predicted 1299
3 SASI_Mm01_00252222 predicted 1128
4 SASI_Mm01_00252223 predicted 887
5 SASI_Mm01_00252224 predicted 1453
6 SASI_Mm01_00252225 predicted 1383
7 SASI_Mm01_00252226 predicted 1096
8 SASI_Mm01_00252227 predicted 1227
9 SASI_Mm01_00252228 predicted 899
10 SASI_Mm01_00252229 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903084 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228608 predicted 628
2 SASI_Mm01_00228609 predicted 641
3 SASI_Mm01_00228610 predicted 1354
4 SASI_Mm01_00228611 predicted 668
5 SASI_Mm01_00228612 predicted 612
6 SASI_Mm01_00228613 predicted 579
7 SASI_Mm01_00228614 predicted 485
8 SASI_Mm01_00228615 predicted 1370
9 SASI_Mm01_00228616 predicted 1321
10 SASI_Mm01_00228617 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235966 predicted 513
2 SASI_Mm01_00235967 predicted 989
3 SASI_Mm01_00235968 predicted 820
4 SASI_Mm01_00235969 predicted 571
5 SASI_Mm01_00235970 predicted 1150
6 SASI_Mm01_00235971 predicted 1077
7 SASI_Mm01_00235972 predicted 785
8 SASI_Mm01_00235973 predicted 918
9 SASI_Mm01_00235974 predicted 586
10 SASI_Mm01_00235975 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271349 predicted 588
2 SASI_Mm01_00271350 predicted 1074
3 SASI_Mm01_00271351 predicted 902
4 SASI_Mm01_00271352 predicted 651
5 SASI_Mm01_00271353 predicted 1228
6 SASI_Mm01_00271354 predicted 1152
7 SASI_Mm01_00271355 predicted 858
8 SASI_Mm01_00271356 predicted 997
9 SASI_Mm01_00271357 predicted 661
10 SASI_Mm01_00271358 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_921865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226047 predicted 583
2 SASI_Mm01_00226048 predicted 1062
3 SASI_Mm01_00226049 predicted 890
4 SASI_Mm01_00226050 predicted 646
5 SASI_Mm01_00226051 predicted 1210
6 SASI_Mm01_00226052 predicted 1140
7 SASI_Mm01_00226053 predicted 849
8 SASI_Mm01_00226054 predicted 985
9 SASI_Mm01_00226055 predicted 651
10 SASI_Mm01_00226056 predicted 973
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015443
VALIDATED
KANSL1 MISSION shRNA Bacterial Glycerol Stock
KAT8 regulatory NSL complex subunit 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015443.2-3427s21c1
Sequence:CCGGACTCACTAACTATTGGCATTACTCGAGTAATGCCAATAGTTAGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015443.2-2010s21c1
Sequence:CCGGACACCATGCCTCCCGAAATTCCTCGAGGAATTTCGGGAGGCATGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015443.2-554s21c1
Sequence:CCGGTTGGCTAAGAAATTGACTAAACTCGAGTTTAGTCAATTTCTTAGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015443.2-1495s21c1
Sequence:CCGGCAAACAGATACGTGCTAATAACTCGAGTTATTAGCACGTATCTGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015443.2-2241s21c1
Sequence:CCGGCTCGTAAGGACAGGCACAAATCTCGAGATTTGTGCCTGTCCTTACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015443.2-263s21c1
Sequence:CCGGAGCCTAGATTTCCGAAATAATCTCGAGATTATTTCGGAAATCTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015443.2-1017s21c1
Sequence:CCGGAGCAGGTTGAGAGGCATATACCTCGAGGTATATGCCTCTCAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015443.2-2078s21c1
Sequence:CCGGGTTCATCCTGTTCTAGCATTTCTCGAGAAATGCTAGAACAGGATGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015443.2-2723s1c1
Sequence:CCGGCTGCAATACAAGGAAATCCTTCTCGAGAAGGATTTCCTTGTATTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015443.2-1268s1c1
Sequence:CCGGGAACAGGCATTTGATTCAGATCTCGAGATCTGAATCAAATGCCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015443.2-262s1c1
Sequence:CCGGCAGCCTAGATTTCCGAAATAACTCGAGTTATTTCGGAAATCTAGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015443.2-2709s1c1
Sequence:CCGGCTCGCGTAGAGAAACTGCAATCTCGAGATTGCAGTTTCTCTACGCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015443.2-2451s1c1
Sequence:CCGGGAGACCATTCATCTGAGAGAACTCGAGTTCTCTCAGATGAATGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015443.2-1263s1c1
Sequence:CCGGGCAGTGAACAGGCATTTGATTCTCGAGAATCAAATGCCTGTTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015443.2-819s1c1
Sequence:CCGGGCAGTAGATTATCACCTGGTACTCGAGTACCAGGTGATAATCTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015443
VALIDATED
KANSL1 MISSION shRNA shRNA Plasmid DNA
KAT8 regulatory NSL complex subunit 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015443.2-3427s21c1
Sequence:CCGGACTCACTAACTATTGGCATTACTCGAGTAATGCCAATAGTTAGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015443.2-2010s21c1
Sequence:CCGGACACCATGCCTCCCGAAATTCCTCGAGGAATTTCGGGAGGCATGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015443.2-554s21c1
Sequence:CCGGTTGGCTAAGAAATTGACTAAACTCGAGTTTAGTCAATTTCTTAGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015443.2-1495s21c1
Sequence:CCGGCAAACAGATACGTGCTAATAACTCGAGTTATTAGCACGTATCTGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015443.2-2241s21c1
Sequence:CCGGCTCGTAAGGACAGGCACAAATCTCGAGATTTGTGCCTGTCCTTACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015443.2-263s21c1
Sequence:CCGGAGCCTAGATTTCCGAAATAATCTCGAGATTATTTCGGAAATCTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015443.2-1017s21c1
Sequence:CCGGAGCAGGTTGAGAGGCATATACCTCGAGGTATATGCCTCTCAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015443.2-2078s21c1
Sequence:CCGGGTTCATCCTGTTCTAGCATTTCTCGAGAAATGCTAGAACAGGATGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015443.2-2723s1c1
Sequence:CCGGCTGCAATACAAGGAAATCCTTCTCGAGAAGGATTTCCTTGTATTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015443.2-1268s1c1
Sequence:CCGGGAACAGGCATTTGATTCAGATCTCGAGATCTGAATCAAATGCCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015443.2-262s1c1
Sequence:CCGGCAGCCTAGATTTCCGAAATAACTCGAGTTATTTCGGAAATCTAGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015443.2-2709s1c1
Sequence:CCGGCTCGCGTAGAGAAACTGCAATCTCGAGATTGCAGTTTCTCTACGCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015443.2-2451s1c1
Sequence:CCGGGAGACCATTCATCTGAGAGAACTCGAGTTCTCTCAGATGAATGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015443.2-1263s1c1
Sequence:CCGGGCAGTGAACAGGCATTTGATTCTCGAGAATCAAATGCCTGTTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015443.2-819s1c1
Sequence:CCGGGCAGTAGATTATCACCTGGTACTCGAGTACCAGGTGATAATCTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015443
VALIDATED
KANSL1 MISSION shRNA Lentiviral Transduction Particles
KAT8 regulatory NSL complex subunit 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015443.2-3427s21c1
Sequence:CCGGACTCACTAACTATTGGCATTACTCGAGTAATGCCAATAGTTAGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015443.2-2010s21c1
Sequence:CCGGACACCATGCCTCCCGAAATTCCTCGAGGAATTTCGGGAGGCATGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015443.2-554s21c1
Sequence:CCGGTTGGCTAAGAAATTGACTAAACTCGAGTTTAGTCAATTTCTTAGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015443.2-1495s21c1
Sequence:CCGGCAAACAGATACGTGCTAATAACTCGAGTTATTAGCACGTATCTGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015443.2-2241s21c1
Sequence:CCGGCTCGTAAGGACAGGCACAAATCTCGAGATTTGTGCCTGTCCTTACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015443.2-263s21c1
Sequence:CCGGAGCCTAGATTTCCGAAATAATCTCGAGATTATTTCGGAAATCTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015443.2-1017s21c1
Sequence:CCGGAGCAGGTTGAGAGGCATATACCTCGAGGTATATGCCTCTCAACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015443.2-2078s21c1
Sequence:CCGGGTTCATCCTGTTCTAGCATTTCTCGAGAAATGCTAGAACAGGATGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015443.2-2723s1c1
Sequence:CCGGCTGCAATACAAGGAAATCCTTCTCGAGAAGGATTTCCTTGTATTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015443.2-1268s1c1
Sequence:CCGGGAACAGGCATTTGATTCAGATCTCGAGATCTGAATCAAATGCCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015443.2-262s1c1
Sequence:CCGGCAGCCTAGATTTCCGAAATAACTCGAGTTATTTCGGAAATCTAGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015443.2-2709s1c1
Sequence:CCGGCTCGCGTAGAGAAACTGCAATCTCGAGATTGCAGTTTCTCTACGCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015443.2-2451s1c1
Sequence:CCGGGAGACCATTCATCTGAGAGAACTCGAGTTCTCTCAGATGAATGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015443.2-1263s1c1
Sequence:CCGGGCAGTGAACAGGCATTTGATTCTCGAGAATCAAATGCCTGTTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015443.2-819s1c1
Sequence:CCGGGCAGTAGATTATCACCTGGTACTCGAGTACCAGGTGATAATCTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081045
VALIDATED
KANSL1 MISSION shRNA Bacterial Glycerol Stock
KAT8 regulatory NSL complex subunit 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081045.1-2060s21c1
Sequence:CCGGCAAACAGATACGTGCTAATAACTCGAGTTATTAGCACGTATCTGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081045.1-757s21c1
Sequence:CCGGATAACGGCAACGCCAATATTCCTCGAGGAATATTGGCGTTGCCGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081045.1-828s21c1
Sequence:CCGGAGTCTAGACTTCCGCAATAATCTCGAGATTATTGCGGAAGTCTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081045.1-1119s21c1
Sequence:CCGGTTGGCTAAGAAATTGACTAAACTCGAGTTTAGTCAATTTCTTAGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081045.1-1300s21c1
Sequence:CCGGTACAACACACAACTCTATATACTCGAGTATATAGAGTTGTGTGTTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081045
VALIDATED
KANSL1 MISSION shRNA shRNA Plasmid DNA
KAT8 regulatory NSL complex subunit 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081045.1-2060s21c1
Sequence:CCGGCAAACAGATACGTGCTAATAACTCGAGTTATTAGCACGTATCTGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081045.1-757s21c1
Sequence:CCGGATAACGGCAACGCCAATATTCCTCGAGGAATATTGGCGTTGCCGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081045.1-828s21c1
Sequence:CCGGAGTCTAGACTTCCGCAATAATCTCGAGATTATTGCGGAAGTCTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081045.1-1119s21c1
Sequence:CCGGTTGGCTAAGAAATTGACTAAACTCGAGTTTAGTCAATTTCTTAGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081045.1-1300s21c1
Sequence:CCGGTACAACACACAACTCTATATACTCGAGTATATAGAGTTGTGTGTTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081045
VALIDATED
KANSL1 MISSION shRNA Lentiviral Transduction Particles
KAT8 regulatory NSL complex subunit 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081045.1-2060s21c1
Sequence:CCGGCAAACAGATACGTGCTAATAACTCGAGTTATTAGCACGTATCTGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081045.1-757s21c1
Sequence:CCGGATAACGGCAACGCCAATATTCCTCGAGGAATATTGGCGTTGCCGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081045.1-828s21c1
Sequence:CCGGAGTCTAGACTTCCGCAATAATCTCGAGATTATTGCGGAAGTCTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081045.1-1119s21c1
Sequence:CCGGTTGGCTAAGAAATTGACTAAACTCGAGTTTAGTCAATTTCTTAGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081045.1-1300s21c1
Sequence:CCGGTACAACACACAACTCTATATACTCGAGTATATAGAGTTGTGTGTTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)