EMAIL THIS PAGE TO A FRIEND

KANSL1L

KAT8 regulatory NSL complex subunit 1-like

138 Gene Product Result for
Synonyms: C2orf67 MSL1v2
Gene ID:
Mouse(68691) KAT8 regulatory NSL complex subunit 1-like
Rat(367289) KAT8 regulatory NSL complex subunit 1-like
Zebrafish(561374) KAT8 regulatory NSL complex subunit 1-like
domestic cat(101098479) KAT8 regulatory NSL complex subunit 1-like
dog(478894) KAT8 regulatory NSL complex subunit 1-like
cow(521270) KAT8 regulatory NSL complex subunit 1-like
domestic guinea pig(100722744) KAT8 regulatory NSL complex subunit 1-like
naked mole-rat(101700064) KAT8 regulatory NSL complex subunit 1-like
sheep(101122579) KAT8 regulatory NSL complex subunit 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152519 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152519 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152519 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001122738 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001122738 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001122738 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU186831 MISSION® esiRNA esiRNA targeting mouse 1110028C15Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152519 Rosetta Predictions human pricing
XM_001053481 Rosetta Predictions rat pricing
XM_001053548 Rosetta Predictions rat pricing
XM_346058 Rosetta Predictions rat pricing
NM_001122738 Rosetta Predictions mouse pricing
NM_177645 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061432 predicted 2844
2 SASI_Hs01_00061433 predicted 1720
3 SASI_Hs02_00366307 predicted 2606
4 SASI_Hs01_00061434 predicted 557
5 SASI_Hs01_00061435 predicted 2816
6 SASI_Hs01_00061437 predicted 361
7 SASI_Hs02_00366308 predicted 2063
8 SASI_Hs01_00061438 predicted 2044
9 SASI_Hs01_00061439 predicted 1644
10 SASI_Hs02_00366309 predicted 1895
11 SASI_Hs01_00061436 predicted 281
12 SASI_Hs01_00061440 predicted 1894
13 SASI_Hs01_00061441 predicted 2929
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272477 predicted 343
2 SASI_Rn02_00272478 predicted 2242
3 SASI_Rn02_00272479 predicted 2733
4 SASI_Rn02_00272480 predicted 2325
5 SASI_Rn02_00272481 predicted 2882
6 SASI_Rn02_00272482 predicted 2127
7 SASI_Rn02_00272483 predicted 2464
8 SASI_Rn02_00272484 predicted 1129
9 SASI_Rn02_00272485 predicted 1473
10 SASI_Rn02_00272486 predicted 1550
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272713 predicted 341
2 SASI_Rn02_00272714 predicted 2853
3 SASI_Rn02_00272715 predicted 3012
4 SASI_Rn02_00272716 predicted 2252
5 SASI_Rn02_00272717 predicted 2593
6 SASI_Rn02_00272718 predicted 1129
7 SASI_Rn02_00272719 predicted 2090
8 SASI_Rn02_00272720 predicted 1478
9 SASI_Rn02_00272721 predicted 2228
10 SASI_Rn02_00272722 predicted 1544
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_346058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399024 predicted 459
2 SASI_Rn02_00399025 predicted 2367
3 SASI_Rn02_00399026 predicted 2848
4 SASI_Rn02_00399027 predicted 271
5 SASI_Rn02_00399028 predicted 3007
6 SASI_Rn02_00399029 predicted 2253
7 SASI_Rn02_00399030 predicted 2588
8 SASI_Rn02_00399031 predicted 1252
9 SASI_Rn02_00399032 predicted 1592
10 SASI_Rn02_00399033 predicted 1675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122738 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309321 predicted 549
2 SASI_Mm02_00309322 predicted 600
3 SASI_Mm02_00309323 predicted 3000
4 SASI_Mm02_00309324 predicted 515
5 SASI_Mm02_00309325 predicted 921
6 SASI_Mm02_00309326 predicted 499
7 SASI_Mm02_00309327 predicted 910
8 SASI_Mm02_00309328 predicted 999
9 SASI_Mm02_00309329 predicted 2521
10 SASI_Mm02_00309330 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177645 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046983 predicted 550
2 SASI_Mm01_00046984 predicted 600
3 SASI_Mm02_00347904 predicted 2977
4 SASI_Mm02_00347905 predicted 510
5 SASI_Mm02_00347906 predicted 922
6 SASI_Mm01_00046986 predicted 499
7 SASI_Mm01_00046987 predicted 910
8 SASI_Mm01_00046989 predicted 993
9 SASI_Mm01_00046990 predicted 2492
10 SASI_Mm01_00046991 predicted 693
11 SASI_Mm01_00046985 predicted 1259
12 SASI_Mm01_00046988 predicted 366
13 SASI_Mm01_00046992 predicted 2593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152519
VALIDATED
KANSL1L MISSION shRNA Bacterial Glycerol Stock
KAT8 regulatory NSL complex subunit 1-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152519.2-4723s1c1
Sequence:CCGGGCGACGTATTCATGGCACAAACTCGAGTTTGTGCCATGAATACGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152519.2-4069s1c1
Sequence:CCGGCCACAAACAGTAAAGCCCTATCTCGAGATAGGGCTTTACTGTTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152519.2-1109s1c1
Sequence:CCGGGCAGAGAATAAATTGTGGGATCTCGAGATCCCACAATTTATTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152519.2-872s1c1
Sequence:CCGGGCTCGTTTACTTCATTGTGTACTCGAGTACACAATGAAGTAAACGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152519.2-362s1c1
Sequence:CCGGCCAACTCCTGAACCTACTCTTCTCGAGAAGAGTAGGTTCAGGAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152519
VALIDATED
KANSL1L MISSION shRNA shRNA Plasmid DNA
KAT8 regulatory NSL complex subunit 1-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152519.2-4723s1c1
Sequence:CCGGGCGACGTATTCATGGCACAAACTCGAGTTTGTGCCATGAATACGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152519.2-4069s1c1
Sequence:CCGGCCACAAACAGTAAAGCCCTATCTCGAGATAGGGCTTTACTGTTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152519.2-1109s1c1
Sequence:CCGGGCAGAGAATAAATTGTGGGATCTCGAGATCCCACAATTTATTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152519.2-872s1c1
Sequence:CCGGGCTCGTTTACTTCATTGTGTACTCGAGTACACAATGAAGTAAACGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152519.2-362s1c1
Sequence:CCGGCCAACTCCTGAACCTACTCTTCTCGAGAAGAGTAGGTTCAGGAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152519
VALIDATED
KANSL1L MISSION shRNA Lentiviral Transduction Particles
KAT8 regulatory NSL complex subunit 1-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152519.2-4723s1c1
Sequence:CCGGGCGACGTATTCATGGCACAAACTCGAGTTTGTGCCATGAATACGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152519.2-4069s1c1
Sequence:CCGGCCACAAACAGTAAAGCCCTATCTCGAGATAGGGCTTTACTGTTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152519.2-1109s1c1
Sequence:CCGGGCAGAGAATAAATTGTGGGATCTCGAGATCCCACAATTTATTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152519.2-872s1c1
Sequence:CCGGGCTCGTTTACTTCATTGTGTACTCGAGTACACAATGAAGTAAACGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152519.2-362s1c1
Sequence:CCGGCCAACTCCTGAACCTACTCTTCTCGAGAAGAGTAGGTTCAGGAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033526
VALIDATED
KANSL1L MISSION shRNA Bacterial Glycerol Stock
KAT8 regulatory NSL complex subunit 1-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033526.1-438s1c1
Sequence:CCGGCGACTCCTGAACCTACTCTAACTCGAGTTAGAGTAGGTTCAGGAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033526.1-713s1c1
Sequence:CCGGCAGTGCATGAAAGATATACAACTCGAGTTGTATATCTTTCATGCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033526.1-2600s1c1
Sequence:CCGGGCAAGTTTACTGATTTCGTATCTCGAGATACGAAATCAGTAAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001033526.1-935s1c1
Sequence:CCGGGAGGAAGTGAATGCTCGTTTACTCGAGTAAACGAGCATTCACTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033526.1-3088s1c1
Sequence:CCGGGCGTCAACAAATGCAAGAATACTCGAGTATTCTTGCATTTGTTGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033526.1-951s1c1
Sequence:CCGGGTTTACTTCATTGTGTGAGTACTCGAGTACTCACACAATGAAGTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033526.1-1202s1c1
Sequence:CCGGGATGATACAAACAATGGCTTTCTCGAGAAAGCCATTGTTTGTATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033526
VALIDATED
KANSL1L MISSION shRNA shRNA Plasmid DNA
KAT8 regulatory NSL complex subunit 1-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033526.1-438s1c1
Sequence:CCGGCGACTCCTGAACCTACTCTAACTCGAGTTAGAGTAGGTTCAGGAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033526.1-713s1c1
Sequence:CCGGCAGTGCATGAAAGATATACAACTCGAGTTGTATATCTTTCATGCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033526.1-2600s1c1
Sequence:CCGGGCAAGTTTACTGATTTCGTATCTCGAGATACGAAATCAGTAAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001033526.1-935s1c1
Sequence:CCGGGAGGAAGTGAATGCTCGTTTACTCGAGTAAACGAGCATTCACTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033526.1-3088s1c1
Sequence:CCGGGCGTCAACAAATGCAAGAATACTCGAGTATTCTTGCATTTGTTGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033526.1-951s1c1
Sequence:CCGGGTTTACTTCATTGTGTGAGTACTCGAGTACTCACACAATGAAGTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033526.1-1202s1c1
Sequence:CCGGGATGATACAAACAATGGCTTTCTCGAGAAAGCCATTGTTTGTATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033526
VALIDATED
KANSL1L MISSION shRNA Lentiviral Transduction Particles
KAT8 regulatory NSL complex subunit 1-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033526.1-438s1c1
Sequence:CCGGCGACTCCTGAACCTACTCTAACTCGAGTTAGAGTAGGTTCAGGAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033526.1-713s1c1
Sequence:CCGGCAGTGCATGAAAGATATACAACTCGAGTTGTATATCTTTCATGCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033526.1-2600s1c1
Sequence:CCGGGCAAGTTTACTGATTTCGTATCTCGAGATACGAAATCAGTAAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001033526.1-935s1c1
Sequence:CCGGGAGGAAGTGAATGCTCGTTTACTCGAGTAAACGAGCATTCACTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033526.1-3088s1c1
Sequence:CCGGGCGTCAACAAATGCAAGAATACTCGAGTATTCTTGCATTTGTTGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033526.1-951s1c1
Sequence:CCGGGTTTACTTCATTGTGTGAGTACTCGAGTACTCACACAATGAAGTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033526.1-1202s1c1
Sequence:CCGGGATGATACAAACAATGGCTTTCTCGAGAAAGCCATTGTTTGTATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001122738
KANSL1L MISSION shRNA Bacterial Glycerol Stock
KAT8 regulatory NSL complex subunit 1-like
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122738.1-3084s21c1
Sequence:CCGGTTTGGTATAGGAGTTACTAATCTCGAGATTAGTAACTCCTATACCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122738.1-3116s21c1
Sequence:CCGGTAGGTGACAGGGAACGTATTACTCGAGTAATACGTTCCCTGTCACCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122738.1-1129s21c1
Sequence:CCGGTTAAGCCAGAAGTCAACATATCTCGAGATATGTTGACTTCTGGCTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001122738.1-3753s1c1
Sequence:CCGGCTTATATCAGATAACGCAATACTCGAGTATTGCGTTATCTGATATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122738.1-3596s21c1
Sequence:CCGGGCATGTATGAATTACTCTATGCTCGAGCATAGAGTAATTCATACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122738.1-1730s21c1
Sequence:CCGGCTCCAGTAGCTGGTTACTTAACTCGAGTTAAGTAACCAGCTACTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001122738
KANSL1L MISSION shRNA shRNA Plasmid DNA
KAT8 regulatory NSL complex subunit 1-like
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122738.1-3084s21c1
Sequence:CCGGTTTGGTATAGGAGTTACTAATCTCGAGATTAGTAACTCCTATACCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122738.1-3116s21c1
Sequence:CCGGTAGGTGACAGGGAACGTATTACTCGAGTAATACGTTCCCTGTCACCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122738.1-1129s21c1
Sequence:CCGGTTAAGCCAGAAGTCAACATATCTCGAGATATGTTGACTTCTGGCTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001122738.1-3753s1c1
Sequence:CCGGCTTATATCAGATAACGCAATACTCGAGTATTGCGTTATCTGATATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122738.1-3596s21c1
Sequence:CCGGGCATGTATGAATTACTCTATGCTCGAGCATAGAGTAATTCATACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122738.1-1730s21c1
Sequence:CCGGCTCCAGTAGCTGGTTACTTAACTCGAGTTAAGTAACCAGCTACTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001122738
KANSL1L MISSION shRNA Lentiviral Transduction Particles
KAT8 regulatory NSL complex subunit 1-like
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122738.1-3084s21c1
Sequence:CCGGTTTGGTATAGGAGTTACTAATCTCGAGATTAGTAACTCCTATACCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122738.1-3116s21c1
Sequence:CCGGTAGGTGACAGGGAACGTATTACTCGAGTAATACGTTCCCTGTCACCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122738.1-1129s21c1
Sequence:CCGGTTAAGCCAGAAGTCAACATATCTCGAGATATGTTGACTTCTGGCTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001122738.1-3753s1c1
Sequence:CCGGCTTATATCAGATAACGCAATACTCGAGTATTGCGTTATCTGATATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122738.1-3596s21c1
Sequence:CCGGGCATGTATGAATTACTCTATGCTCGAGCATAGAGTAATTCATACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122738.1-1730s21c1
Sequence:CCGGCTCCAGTAGCTGGTTACTTAACTCGAGTTAAGTAACCAGCTACTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)