EMAIL THIS PAGE TO A FRIEND

KANSL2

KAT8 regulatory NSL complex subunit 2

116 Gene Product Result for
Synonyms: C12orf41 NSL2
UniProtKB ID: Q9H9L4, Q8N3B5, Q96CV0, Q9NX51
Gene ID:
Mouse(69612) KAT8 regulatory NSL complex subunit 2
Rat(300206) KAT8 regulatory NSL complex subunit 2
sheep(101106671) KAT8 regulatory NSL complex subunit 2
domestic guinea pig(100731954) KAT8 regulatory NSL complex subunit 2
naked mole-rat(101700871) KAT8 regulatory NSL complex subunit 2
Zebrafish(449817) KAT8 regulatory NSL complex subunit 2
cow(540194) KAT8 regulatory NSL complex subunit 2
domestic cat(101090449) KAT8 regulatory NSL complex subunit 2
dog(609028) KAT8 regulatory NSL complex subunit 2
chicken(426401) KAT8 regulatory NSL complex subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017822 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017822 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017822 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133714 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133714 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133714 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062161 MISSION® esiRNA esiRNA human C12orf41 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017822 Rosetta Predictions human pricing
NM_001004244 Rosetta Predictions rat pricing
NM_133714 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247424 predicted 1058
2 SASI_Hs01_00247425 predicted 683
3 SASI_Hs02_00350691 predicted 818
4 SASI_Hs01_00247426 predicted 1110
5 SASI_Hs01_00247427 predicted 1305
6 SASI_Hs01_00247428 predicted 743
7 SASI_Hs02_00350692 predicted 211
8 SASI_Hs02_00350693 predicted 1515
9 SASI_Hs02_00350694 predicted 254
10 SASI_Hs01_00247429 predicted 1537
11 SASI_Hs01_00247430 predicted 951
12 SASI_Hs01_00247431 predicted 967
13 SASI_Hs01_00247432 predicted 1083
14 SASI_Hs01_00247433 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004244 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090220 predicted 971
2 SASI_Rn02_00198253 predicted 806
3 SASI_Rn02_00198254 predicted 810
4 SASI_Rn02_00198255 predicted 762
5 SASI_Rn01_00090224 predicted 658
6 SASI_Rn02_00198256 predicted 1026
7 SASI_Rn01_00090225 predicted 676
8 SASI_Rn02_00198257 predicted 678
9 SASI_Rn02_00198258 predicted 976
10 SASI_Rn01_00090226 predicted 600
11 SASI_Rn01_00090221 predicted 883
12 SASI_Rn01_00090222 predicted 647
13 SASI_Rn01_00090223 predicted 1388
14 SASI_Rn01_00090227 predicted 1342
15 SASI_Rn01_00090228 predicted 829
16 SASI_Rn01_00090229 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133714 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150923 predicted 1296
2 SASI_Mm01_00150924 predicted 900
3 SASI_Mm02_00338685 predicted 1128
4 SASI_Mm01_00150925 predicted 837
5 SASI_Mm02_00338686 predicted 1127
6 SASI_Mm01_00150926 predicted 992
7 SASI_Mm01_00150927 predicted 990
8 SASI_Mm01_00150928 predicted 1082
9 SASI_Mm01_00150930 predicted 990
10 SASI_Mm01_00150931 predicted 978
11 SASI_Mm01_00150929 predicted 1571
12 SASI_Mm01_00150932 predicted 1279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017822
KANSL2 MISSION shRNA Bacterial Glycerol Stock
KAT8 regulatory NSL complex subunit 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017822.3-575s21c1
Sequence:CCGGACAGTGAAGCTGATAGCATAGCTCGAGCTATGCTATCAGCTTCACTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017822.3-1753s21c1
Sequence:CCGGGAGAGATAATCCCTATCAAAGCTCGAGCTTTGATAGGGATTATCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017822.3-1669s21c1
Sequence:CCGGGATTGAGTATTATAGTCAAACCTCGAGGTTTGACTATAATACTCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017822.3-1169s21c1
Sequence:CCGGAGTTGCCTCCTCAGATGTATACTCGAGTATACATCTGAGGAGGCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017822.3-221s21c1
Sequence:CCGGATATCCTTGAAGACAAGAATGCTCGAGCATTCTTGTCTTCAAGGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017822.3-1265s21c1
Sequence:CCGGTTCAGCCCACTGAGAGTTTACCTCGAGGTAAACTCTCAGTGGGCTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017822.3-1900s21c1
Sequence:CCGGAGATACTGATGGCCCTAATATCTCGAGATATTAGGGCCATCAGTATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017822.2-437s1c1
Sequence:CCGGCCAGAAAGTAGTCGCAGTGAACTCGAGTTCACTGCGACTACTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017822.2-458s1c1
Sequence:CCGGGCCAGCCGAATACTAGATGAACTCGAGTTCATCTAGTATTCGGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017822.2-1780s1c1
Sequence:CCGGGACATCTTTGTAATGGGATTTCTCGAGAAATCCCATTACAAAGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017822.2-797s1c1
Sequence:CCGGCGAGAGAACTTAAAGCGATTACTCGAGTAATCGCTTTAAGTTCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017822.2-713s1c1
Sequence:CCGGCGATACTTACATAATCGCAAACTCGAGTTTGCGATTATGTAAGTATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017822
KANSL2 MISSION shRNA shRNA Plasmid DNA
KAT8 regulatory NSL complex subunit 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017822.3-575s21c1
Sequence:CCGGACAGTGAAGCTGATAGCATAGCTCGAGCTATGCTATCAGCTTCACTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017822.3-1753s21c1
Sequence:CCGGGAGAGATAATCCCTATCAAAGCTCGAGCTTTGATAGGGATTATCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017822.3-1669s21c1
Sequence:CCGGGATTGAGTATTATAGTCAAACCTCGAGGTTTGACTATAATACTCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017822.3-1169s21c1
Sequence:CCGGAGTTGCCTCCTCAGATGTATACTCGAGTATACATCTGAGGAGGCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017822.3-221s21c1
Sequence:CCGGATATCCTTGAAGACAAGAATGCTCGAGCATTCTTGTCTTCAAGGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017822.3-1265s21c1
Sequence:CCGGTTCAGCCCACTGAGAGTTTACCTCGAGGTAAACTCTCAGTGGGCTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017822.3-1900s21c1
Sequence:CCGGAGATACTGATGGCCCTAATATCTCGAGATATTAGGGCCATCAGTATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017822.2-437s1c1
Sequence:CCGGCCAGAAAGTAGTCGCAGTGAACTCGAGTTCACTGCGACTACTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017822.2-458s1c1
Sequence:CCGGGCCAGCCGAATACTAGATGAACTCGAGTTCATCTAGTATTCGGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017822.2-1780s1c1
Sequence:CCGGGACATCTTTGTAATGGGATTTCTCGAGAAATCCCATTACAAAGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017822.2-797s1c1
Sequence:CCGGCGAGAGAACTTAAAGCGATTACTCGAGTAATCGCTTTAAGTTCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017822.2-713s1c1
Sequence:CCGGCGATACTTACATAATCGCAAACTCGAGTTTGCGATTATGTAAGTATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017822
KANSL2 MISSION shRNA Lentiviral Transduction Particles
KAT8 regulatory NSL complex subunit 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017822.3-575s21c1
Sequence:CCGGACAGTGAAGCTGATAGCATAGCTCGAGCTATGCTATCAGCTTCACTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017822.3-1753s21c1
Sequence:CCGGGAGAGATAATCCCTATCAAAGCTCGAGCTTTGATAGGGATTATCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017822.3-1669s21c1
Sequence:CCGGGATTGAGTATTATAGTCAAACCTCGAGGTTTGACTATAATACTCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017822.3-1169s21c1
Sequence:CCGGAGTTGCCTCCTCAGATGTATACTCGAGTATACATCTGAGGAGGCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017822.3-221s21c1
Sequence:CCGGATATCCTTGAAGACAAGAATGCTCGAGCATTCTTGTCTTCAAGGATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017822.3-1265s21c1
Sequence:CCGGTTCAGCCCACTGAGAGTTTACCTCGAGGTAAACTCTCAGTGGGCTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017822.3-1900s21c1
Sequence:CCGGAGATACTGATGGCCCTAATATCTCGAGATATTAGGGCCATCAGTATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017822.2-437s1c1
Sequence:CCGGCCAGAAAGTAGTCGCAGTGAACTCGAGTTCACTGCGACTACTTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017822.2-458s1c1
Sequence:CCGGGCCAGCCGAATACTAGATGAACTCGAGTTCATCTAGTATTCGGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017822.2-1780s1c1
Sequence:CCGGGACATCTTTGTAATGGGATTTCTCGAGAAATCCCATTACAAAGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017822.2-797s1c1
Sequence:CCGGCGAGAGAACTTAAAGCGATTACTCGAGTAATCGCTTTAAGTTCTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017822.2-713s1c1
Sequence:CCGGCGATACTTACATAATCGCAAACTCGAGTTTGCGATTATGTAAGTATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133714
VALIDATED
KANSL2 MISSION shRNA Bacterial Glycerol Stock
KAT8 regulatory NSL complex subunit 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133714.4-1914s1c1
Sequence:CCGGGCGCTATAGACAAACATAATCCTCGAGGATTATGTTTGTCTATAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133714.2-2184s1c1
Sequence:CCGGGCTGTATCTAAAGGCCTGTATCTCGAGATACAGGCCTTTAGATACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133714.2-1631s1c1
Sequence:CCGGCCTTCGCTAACTCTTGAAGATCTCGAGATCTTCAAGAGTTAGCGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133714.2-1015s1c1
Sequence:CCGGCCGCTATTTACACAACCGGAACTCGAGTTCCGGTTGTGTAAATAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133714.2-1319s1c1
Sequence:CCGGCATATCTGTCAGGATACAAATCTCGAGATTTGTATCCTGACAGATATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194213    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133714.2-2220s1c1
Sequence:CCGGGCTCTACATAGTTGGGCAATACTCGAGTATTGCCCAACTATGTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133714.2-1383s1c1
Sequence:CCGGGCAACAAACCAGTTCCTGTAACTCGAGTTACAGGAACTGGTTTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133714
VALIDATED
KANSL2 MISSION shRNA shRNA Plasmid DNA
KAT8 regulatory NSL complex subunit 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133714.4-1914s1c1
Sequence:CCGGGCGCTATAGACAAACATAATCCTCGAGGATTATGTTTGTCTATAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133714.2-2184s1c1
Sequence:CCGGGCTGTATCTAAAGGCCTGTATCTCGAGATACAGGCCTTTAGATACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133714.2-1631s1c1
Sequence:CCGGCCTTCGCTAACTCTTGAAGATCTCGAGATCTTCAAGAGTTAGCGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133714.2-1015s1c1
Sequence:CCGGCCGCTATTTACACAACCGGAACTCGAGTTCCGGTTGTGTAAATAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133714.2-1319s1c1
Sequence:CCGGCATATCTGTCAGGATACAAATCTCGAGATTTGTATCCTGACAGATATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194213    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133714.2-2220s1c1
Sequence:CCGGGCTCTACATAGTTGGGCAATACTCGAGTATTGCCCAACTATGTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133714.2-1383s1c1
Sequence:CCGGGCAACAAACCAGTTCCTGTAACTCGAGTTACAGGAACTGGTTTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133714
VALIDATED
KANSL2 MISSION shRNA Lentiviral Transduction Particles
KAT8 regulatory NSL complex subunit 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133714.4-1914s1c1
Sequence:CCGGGCGCTATAGACAAACATAATCCTCGAGGATTATGTTTGTCTATAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133714.2-2184s1c1
Sequence:CCGGGCTGTATCTAAAGGCCTGTATCTCGAGATACAGGCCTTTAGATACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133714.2-1631s1c1
Sequence:CCGGCCTTCGCTAACTCTTGAAGATCTCGAGATCTTCAAGAGTTAGCGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133714.2-1015s1c1
Sequence:CCGGCCGCTATTTACACAACCGGAACTCGAGTTCCGGTTGTGTAAATAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133714.2-1319s1c1
Sequence:CCGGCATATCTGTCAGGATACAAATCTCGAGATTTGTATCCTGACAGATATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194213    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133714.2-2220s1c1
Sequence:CCGGGCTCTACATAGTTGGGCAATACTCGAGTATTGCCCAACTATGTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133714.2-1383s1c1
Sequence:CCGGGCAACAAACCAGTTCCTGTAACTCGAGTTACAGGAACTGGTTTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)