EMAIL THIS PAGE TO A FRIEND

KANSL3

KAT8 regulatory NSL complex subunit 3

126 Gene Product Result for
Synonyms: KIAA1310 NSL3 Rcd1
Gene ID:
Mouse(226976) KAT8 regulatory NSL complex subunit 3
Rat(316328) KAT8 regulatory NSL complex subunit 3
sheep(101111870) KAT8 regulatory NSL complex subunit 3
domestic guinea pig(100726123) KAT8 regulatory NSL complex subunit 3
naked mole-rat(101708054) KAT8 regulatory NSL complex subunit 3
Zebrafish(555951) KAT8 regulatory NSL complex subunit 3
domestic cat(101092175) KAT8 regulatory NSL complex subunit 3
dog(481348) KAT8 regulatory NSL complex subunit 3
chicken(426585) KAT8 regulatory NSL complex subunit 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172652 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172652 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172652 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017991 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017991 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017991 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001115016 Rosetta Predictions human pricing
NM_017991 Rosetta Predictions human pricing
NM_001034835 Rosetta Predictions rat pricing
NM_172652 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326936 predicted 2782
2 SASI_Hs02_00326937 predicted 1404
3 SASI_Hs02_00326938 predicted 2792
4 SASI_Hs02_00326939 predicted 1360
5 SASI_Hs02_00326940 predicted 1345
6 SASI_Hs02_00326941 predicted 2139
7 SASI_Hs02_00326942 predicted 1926
8 SASI_Hs02_00326943 predicted 1221
9 SASI_Hs02_00326944 predicted 1638
10 SASI_Hs02_00326945 predicted 1450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236031 predicted 2842
2 SASI_Hs01_00236032 predicted 1464
3 SASI_Hs01_00236033 predicted 2854
4 SASI_Hs02_00351041 predicted 1422
5 SASI_Hs01_00236035 predicted 1402
6 SASI_Hs02_00351042 predicted 2199
7 SASI_Hs01_00236038 predicted 1983
8 SASI_Hs01_00236039 predicted 1282
9 SASI_Hs02_00351043 predicted 1705
10 SASI_Hs02_00351044 predicted 1514
11 SASI_Hs01_00236034 predicted 477
12 SASI_Hs01_00236036 predicted 1558
13 SASI_Hs01_00236037 predicted 445
14 SASI_Hs01_00236040 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034835 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115877 predicted 289
2 SASI_Rn01_00115878 predicted 1149
3 SASI_Rn01_00115879 predicted 1800
4 SASI_Rn01_00115880 predicted 331
5 SASI_Rn02_00204037 predicted 1057
6 SASI_Rn01_00115881 predicted 1455
7 SASI_Rn01_00115882 predicted 1441
8 SASI_Rn01_00115883 predicted 2077
9 SASI_Rn01_00115884 predicted 2263
10 SASI_Rn02_00204038 predicted 2527
11 SASI_Rn01_00115885 predicted 725
12 SASI_Rn01_00115886 predicted 2082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022316 predicted 412
2 SASI_Mm01_00022317 predicted 1859
3 SASI_Mm01_00022318 predicted 534
4 SASI_Mm01_00022319 predicted 2139
5 SASI_Mm01_00022320 predicted 2719
6 SASI_Mm01_00022321 predicted 351
7 SASI_Mm01_00022322 predicted 1207
8 SASI_Mm01_00022323 predicted 1962
9 SASI_Mm01_00022324 predicted 2119
10 SASI_Mm01_00022325 predicted 2588
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172652
VALIDATED
KANSL3 MISSION shRNA Bacterial Glycerol Stock
KAT8 regulatory NSL complex subunit 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000266994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172652.3-529s21c1
Sequence:CCGGTGGCTCAGAATAAGCTATTTACTCGAGTAAATAGCTTATTCTGAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172652.3-381s21c1
Sequence:CCGGGCAACTCCTGTTCCACTTTATCTCGAGATAAAGTGGAACAGGAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172652.3-1488s21c1
Sequence:CCGGAGCATGGTGGACAGATGTATTCTCGAGAATACATCTGTCCACCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172652.1-388s1c1
Sequence:CCGGCCTGTTCCACTTTATGACAATCTCGAGATTGTCATAAAGTGGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172652.3-1321s21c1
Sequence:CCGGCTCCAGTCCTCTTCGTCATTGCTCGAGCAATGACGAAGAGGACTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172652.3-2594s1c1
Sequence:CCGGCAACCAAGCATCAGGCTTAAACTCGAGTTTAAGCCTGATGCTTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179171    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172652.1-3310s1c1
Sequence:CCGGGCCTAAGAAGAGCTAGAGAAACTCGAGTTTCTCTAGCTCTTCTTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172652.1-3465s1c1
Sequence:CCGGGCTTCAAAGTTTGTCTCCTTTCTCGAGAAAGGAGACAAACTTTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172652.3-3988s21c1
Sequence:CCGGTTCATAGGTCAGAGCATATAACTCGAGTTATATGCTCTGACCTATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172652
VALIDATED
KANSL3 MISSION shRNA shRNA Plasmid DNA
KAT8 regulatory NSL complex subunit 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000266994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172652.3-529s21c1
Sequence:CCGGTGGCTCAGAATAAGCTATTTACTCGAGTAAATAGCTTATTCTGAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172652.3-381s21c1
Sequence:CCGGGCAACTCCTGTTCCACTTTATCTCGAGATAAAGTGGAACAGGAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172652.3-1488s21c1
Sequence:CCGGAGCATGGTGGACAGATGTATTCTCGAGAATACATCTGTCCACCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172652.1-388s1c1
Sequence:CCGGCCTGTTCCACTTTATGACAATCTCGAGATTGTCATAAAGTGGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172652.3-1321s21c1
Sequence:CCGGCTCCAGTCCTCTTCGTCATTGCTCGAGCAATGACGAAGAGGACTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172652.3-2594s1c1
Sequence:CCGGCAACCAAGCATCAGGCTTAAACTCGAGTTTAAGCCTGATGCTTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179171    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172652.1-3310s1c1
Sequence:CCGGGCCTAAGAAGAGCTAGAGAAACTCGAGTTTCTCTAGCTCTTCTTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172652.1-3465s1c1
Sequence:CCGGGCTTCAAAGTTTGTCTCCTTTCTCGAGAAAGGAGACAAACTTTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172652.3-3988s21c1
Sequence:CCGGTTCATAGGTCAGAGCATATAACTCGAGTTATATGCTCTGACCTATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172652
VALIDATED
KANSL3 MISSION shRNA Lentiviral Transduction Particles
KAT8 regulatory NSL complex subunit 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000266994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172652.3-529s21c1
Sequence:CCGGTGGCTCAGAATAAGCTATTTACTCGAGTAAATAGCTTATTCTGAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172652.3-381s21c1
Sequence:CCGGGCAACTCCTGTTCCACTTTATCTCGAGATAAAGTGGAACAGGAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172652.3-1488s21c1
Sequence:CCGGAGCATGGTGGACAGATGTATTCTCGAGAATACATCTGTCCACCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172652.1-388s1c1
Sequence:CCGGCCTGTTCCACTTTATGACAATCTCGAGATTGTCATAAAGTGGAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172652.3-1321s21c1
Sequence:CCGGCTCCAGTCCTCTTCGTCATTGCTCGAGCAATGACGAAGAGGACTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172652.3-2594s1c1
Sequence:CCGGCAACCAAGCATCAGGCTTAAACTCGAGTTTAAGCCTGATGCTTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179171    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172652.1-3310s1c1
Sequence:CCGGGCCTAAGAAGAGCTAGAGAAACTCGAGTTTCTCTAGCTCTTCTTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172652.1-3465s1c1
Sequence:CCGGGCTTCAAAGTTTGTCTCCTTTCTCGAGAAAGGAGACAAACTTTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172652.3-3988s21c1
Sequence:CCGGTTCATAGGTCAGAGCATATAACTCGAGTTATATGCTCTGACCTATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017991
VALIDATED
KANSL3 MISSION shRNA Bacterial Glycerol Stock
KAT8 regulatory NSL complex subunit 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017991.3-1476s1c1
Sequence:CCGGGAGCTGATGACAATCTCAGAACTCGAGTTCTGAGATTGTCATCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017991.3-2029s1c1
Sequence:CCGGGAAGATCAAGGTGTCCCTTATCTCGAGATAAGGGACACCTTGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017991.3-862s1c1
Sequence:CCGGGCTTGTGTCATCCAACACAAACTCGAGTTTGTGTTGGATGACACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017991.4-1977s21c1
Sequence:CCGGAGGAGAGAAAGAGGATCTTAGCTCGAGCTAAGATCCTCTTTCTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017991.4-1567s21c1
Sequence:CCGGAGCATGGTGGACAGATGTATTCTCGAGAATACATCTGTCCACCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017991.4-1234s21c1
Sequence:CCGGTTCCCACACAAACCCATTATCCTCGAGGATAATGGGTTTGTGTGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017991.4-1284s21c1
Sequence:CCGGGGCCTGTCATGTGTCAGTAATCTCGAGATTACTGACACATGACAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017991.3-4102s1c1
Sequence:CCGGGCTCCCATACTTAGAATGTTTCTCGAGAAACATTCTAAGTATGGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017991.3-1204s1c1
Sequence:CCGGCCCACACAAACCCATTATCTTCTCGAGAAGATAATGGGTTTGTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017991.3-3828s1c1
Sequence:CCGGCCCAGGAAACTTGTGGCATTACTCGAGTAATGCCACAAGTTTCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017991.3-2710s1c1
Sequence:CCGGGATCACTACACTGAGCCCTATCTCGAGATAGGGCTCAGTGTAGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017991.4-515s21c1
Sequence:CCGGGTGAACGGCATGTCATCTTTGCTCGAGCAAAGATGACATGCCGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017991
VALIDATED
KANSL3 MISSION shRNA shRNA Plasmid DNA
KAT8 regulatory NSL complex subunit 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017991.3-1476s1c1
Sequence:CCGGGAGCTGATGACAATCTCAGAACTCGAGTTCTGAGATTGTCATCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017991.3-2029s1c1
Sequence:CCGGGAAGATCAAGGTGTCCCTTATCTCGAGATAAGGGACACCTTGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017991.3-862s1c1
Sequence:CCGGGCTTGTGTCATCCAACACAAACTCGAGTTTGTGTTGGATGACACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017991.4-1977s21c1
Sequence:CCGGAGGAGAGAAAGAGGATCTTAGCTCGAGCTAAGATCCTCTTTCTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017991.4-1567s21c1
Sequence:CCGGAGCATGGTGGACAGATGTATTCTCGAGAATACATCTGTCCACCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017991.4-1234s21c1
Sequence:CCGGTTCCCACACAAACCCATTATCCTCGAGGATAATGGGTTTGTGTGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017991.4-1284s21c1
Sequence:CCGGGGCCTGTCATGTGTCAGTAATCTCGAGATTACTGACACATGACAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017991.3-4102s1c1
Sequence:CCGGGCTCCCATACTTAGAATGTTTCTCGAGAAACATTCTAAGTATGGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017991.3-1204s1c1
Sequence:CCGGCCCACACAAACCCATTATCTTCTCGAGAAGATAATGGGTTTGTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017991.3-3828s1c1
Sequence:CCGGCCCAGGAAACTTGTGGCATTACTCGAGTAATGCCACAAGTTTCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017991.3-2710s1c1
Sequence:CCGGGATCACTACACTGAGCCCTATCTCGAGATAGGGCTCAGTGTAGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017991.4-515s21c1
Sequence:CCGGGTGAACGGCATGTCATCTTTGCTCGAGCAAAGATGACATGCCGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017991
VALIDATED
KANSL3 MISSION shRNA Lentiviral Transduction Particles
KAT8 regulatory NSL complex subunit 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017991.3-1476s1c1
Sequence:CCGGGAGCTGATGACAATCTCAGAACTCGAGTTCTGAGATTGTCATCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017991.3-2029s1c1
Sequence:CCGGGAAGATCAAGGTGTCCCTTATCTCGAGATAAGGGACACCTTGATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017991.3-862s1c1
Sequence:CCGGGCTTGTGTCATCCAACACAAACTCGAGTTTGTGTTGGATGACACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017991.4-1977s21c1
Sequence:CCGGAGGAGAGAAAGAGGATCTTAGCTCGAGCTAAGATCCTCTTTCTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017991.4-1567s21c1
Sequence:CCGGAGCATGGTGGACAGATGTATTCTCGAGAATACATCTGTCCACCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017991.4-1234s21c1
Sequence:CCGGTTCCCACACAAACCCATTATCCTCGAGGATAATGGGTTTGTGTGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017991.4-1284s21c1
Sequence:CCGGGGCCTGTCATGTGTCAGTAATCTCGAGATTACTGACACATGACAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017991.3-4102s1c1
Sequence:CCGGGCTCCCATACTTAGAATGTTTCTCGAGAAACATTCTAAGTATGGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017991.3-1204s1c1
Sequence:CCGGCCCACACAAACCCATTATCTTCTCGAGAAGATAATGGGTTTGTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017991.3-3828s1c1
Sequence:CCGGCCCAGGAAACTTGTGGCATTACTCGAGTAATGCCACAAGTTTCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017991.3-2710s1c1
Sequence:CCGGGATCACTACACTGAGCCCTATCTCGAGATAGGGCTCAGTGTAGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017991.4-515s21c1
Sequence:CCGGGTGAACGGCATGTCATCTTTGCTCGAGCAAAGATGACATGCCGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)