EMAIL THIS PAGE TO A FRIEND

KARS

lysyl-tRNA synthetase

62 Gene Product Result for
Synonyms: CMTRIB DFNB89 KARS1 KARS2 KRS
UniProtKB ID: Q15046, A8MSK1, D3DUK4, O14946, Q96J25, Q9HB23
Gene ID:
Human(3735) Summary: Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. Lysyl-tRNA synthetase is a homodimer localized to the cytoplasm which belongs to the class II family of tRNA synthetases. It has been shown to be a target of autoantibodies in the human autoimmune diseases, polymyositis or dermatomyositis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(85305) lysyl-tRNA synthetase
Rat(292028) lysyl-tRNA synthetase
Zebrafish(280647) lysyl-tRNA synthetase
chicken(415885) lysyl-tRNA synthetase
Horse(100055335) lysyl-tRNA synthetase
cow(509624) lysyl-tRNA synthetase
domestic cat(101092570) lysyl-tRNA synthetase
dog(479644) lysyl-tRNA synthetase
sheep(101118293) lysyl-tRNA synthetase
Domestic Rabbit(100343643) lysyl-tRNA synthetase
domestic guinea pig(100722175) lysyl-tRNA synthetase
naked mole-rat(101704062) lysyl-tRNA synthetase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053092 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053092 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053092 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005548 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005548 Rosetta Predictions human pricing
NM_001006967 Rosetta Predictions rat pricing
NM_001130868 Rosetta Predictions mouse pricing
NM_053092 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136734 predicted 1527
2 SASI_Hs01_00136735 predicted 1512
3 SASI_Hs02_00339790 predicted 1075
4 SASI_Hs01_00136736 predicted 1031
5 SASI_Hs01_00136737 predicted 1679
6 SASI_Hs01_00136738 predicted 1455
7 SASI_Hs01_00136739 predicted 909
8 SASI_Hs01_00136740 predicted 1133
9 SASI_Hs01_00136741 predicted 1390
10 SASI_Hs01_00136742 predicted 1098
11 SASI_Hs01_00136743 predicted 1439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101594 predicted 1268
2 SASI_Rn01_00101595 predicted 1153
3 SASI_Rn01_00101596 predicted 1284
4 SASI_Rn01_00101597 predicted 857
5 SASI_Rn01_00101598 predicted 1172
6 SASI_Rn02_00198521 predicted 1869
7 SASI_Rn01_00101599 predicted 677
8 SASI_Rn01_00101600 predicted 1533
9 SASI_Rn01_00101601 predicted 341
10 SASI_Rn01_00101602 predicted 913
11 SASI_Rn01_00101603 predicted 1355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311410 predicted 879
2 SASI_Mm02_00311411 predicted 1181
3 SASI_Mm02_00311412 predicted 1690
4 SASI_Mm02_00311413 predicted 1305
5 SASI_Mm02_00311414 predicted 1598
6 SASI_Mm02_00311415 predicted 1697
7 SASI_Mm02_00311416 predicted 1300
8 SASI_Mm02_00311417 predicted 1471
9 SASI_Mm02_00311418 predicted 696
10 SASI_Mm02_00311419 predicted 1740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053092 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078134 predicted 700
2 SASI_Mm02_00337587 predicted 998
3 SASI_Mm01_00078136 predicted 1511
4 SASI_Mm02_00337588 predicted 1126
5 SASI_Mm01_00078137 predicted 1426
6 SASI_Mm01_00078138 predicted 1515
7 SASI_Mm01_00078139 predicted 1119
8 SASI_Mm01_00078140 predicted 1298
9 SASI_Mm01_00078141 predicted 519
10 SASI_Mm01_00078142 predicted 1558
11 SASI_Mm01_00078133 predicted 308
12 SASI_Mm01_00078135 predicted 872
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053092
VALIDATED
KARS MISSION shRNA Bacterial Glycerol Stock
lysyl-tRNA synthetase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053092.1-732s1c1
Sequence:CCGGCCGCTCTAAGATCATCACATACTCGAGTATGTGATGATCTTAGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053092.1-1167s1c1
Sequence:CCGGCCGAAGAATCAGCATGGTAGACTCGAGTCTACCATGCTGATTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053092.1-123s1c1
Sequence:CCGGGCTGAGTGAGAAACAGCTAAACTCGAGTTTAGCTGTTTCTCACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053092.1-861s1c1
Sequence:CCGGGCTGGACATGAACTTGTATATCTCGAGATATACAAGTTCATGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053092.1-1798s1c2
Sequence:CCGGGCAACTATGGTGTCTGCATCTCTCGAGAGATGCAGACACCATAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053092
VALIDATED
KARS MISSION shRNA shRNA Plasmid DNA
lysyl-tRNA synthetase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053092.1-732s1c1
Sequence:CCGGCCGCTCTAAGATCATCACATACTCGAGTATGTGATGATCTTAGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053092.1-1167s1c1
Sequence:CCGGCCGAAGAATCAGCATGGTAGACTCGAGTCTACCATGCTGATTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053092.1-123s1c1
Sequence:CCGGGCTGAGTGAGAAACAGCTAAACTCGAGTTTAGCTGTTTCTCACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053092.1-861s1c1
Sequence:CCGGGCTGGACATGAACTTGTATATCTCGAGATATACAAGTTCATGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053092.1-1798s1c2
Sequence:CCGGGCAACTATGGTGTCTGCATCTCTCGAGAGATGCAGACACCATAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053092
VALIDATED
KARS MISSION shRNA Lentiviral Transduction Particles
lysyl-tRNA synthetase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053092.1-732s1c1
Sequence:CCGGCCGCTCTAAGATCATCACATACTCGAGTATGTGATGATCTTAGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053092.1-1167s1c1
Sequence:CCGGCCGAAGAATCAGCATGGTAGACTCGAGTCTACCATGCTGATTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053092.1-123s1c1
Sequence:CCGGGCTGAGTGAGAAACAGCTAAACTCGAGTTTAGCTGTTTCTCACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053092.1-861s1c1
Sequence:CCGGGCTGGACATGAACTTGTATATCTCGAGATATACAAGTTCATGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053092.1-1798s1c2
Sequence:CCGGGCAACTATGGTGTCTGCATCTCTCGAGAGATGCAGACACCATAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005548
VALIDATED
KARS MISSION shRNA Bacterial Glycerol Stock
lysyl-tRNA synthetase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005548.1-1214s1c1
Sequence:CCGGCGGCGAATCAACATGGTAGAACTCGAGTTCTACCATGTTGATTCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005548.1-250s1c1
Sequence:CCGGCGTGGACCCAAATCAATACTACTCGAGTAGTATTGATTTGGGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005548.1-724s1c1
Sequence:CCGGCCAGAGATACTTGGACTTGATCTCGAGATCAAGTCCAAGTATCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005548.1-1393s1c1
Sequence:CCGGCCTGGAAGTGACTTGCATCAACTCGAGTTGATGCAAGTCACTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005548.1-883s1c1
Sequence:CCGGGCCTTTCATCACTTATCACAACTCGAGTTGTGATAAGTGATGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005548.2-258s21c1
Sequence:CCGGCGTGGACCCAAATCAATACTACTCGAGTAGTATTGATTTGGGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005548.2-1401s21c1
Sequence:CCGGCCTGGAAGTGACTTGCATCAACTCGAGTTGATGCAAGTCACTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005548.2-891s21c1
Sequence:CCGGGCCTTTCATCACTTATCACAACTCGAGTTGTGATAAGTGATGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005548.2-732s21c1
Sequence:CCGGCCAGAGATACTTGGACTTGATCTCGAGATCAAGTCCAAGTATCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005548
VALIDATED
KARS MISSION shRNA shRNA Plasmid DNA
lysyl-tRNA synthetase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005548.1-1214s1c1
Sequence:CCGGCGGCGAATCAACATGGTAGAACTCGAGTTCTACCATGTTGATTCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005548.1-250s1c1
Sequence:CCGGCGTGGACCCAAATCAATACTACTCGAGTAGTATTGATTTGGGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005548.1-724s1c1
Sequence:CCGGCCAGAGATACTTGGACTTGATCTCGAGATCAAGTCCAAGTATCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005548.1-1393s1c1
Sequence:CCGGCCTGGAAGTGACTTGCATCAACTCGAGTTGATGCAAGTCACTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005548.1-883s1c1
Sequence:CCGGGCCTTTCATCACTTATCACAACTCGAGTTGTGATAAGTGATGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005548.2-258s21c1
Sequence:CCGGCGTGGACCCAAATCAATACTACTCGAGTAGTATTGATTTGGGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005548.2-1401s21c1
Sequence:CCGGCCTGGAAGTGACTTGCATCAACTCGAGTTGATGCAAGTCACTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005548.2-891s21c1
Sequence:CCGGGCCTTTCATCACTTATCACAACTCGAGTTGTGATAAGTGATGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005548.2-732s21c1
Sequence:CCGGCCAGAGATACTTGGACTTGATCTCGAGATCAAGTCCAAGTATCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005548
VALIDATED
KARS MISSION shRNA Lentiviral Transduction Particles
lysyl-tRNA synthetase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005548.1-1214s1c1
Sequence:CCGGCGGCGAATCAACATGGTAGAACTCGAGTTCTACCATGTTGATTCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005548.1-250s1c1
Sequence:CCGGCGTGGACCCAAATCAATACTACTCGAGTAGTATTGATTTGGGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005548.1-724s1c1
Sequence:CCGGCCAGAGATACTTGGACTTGATCTCGAGATCAAGTCCAAGTATCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005548.1-1393s1c1
Sequence:CCGGCCTGGAAGTGACTTGCATCAACTCGAGTTGATGCAAGTCACTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005548.1-883s1c1
Sequence:CCGGGCCTTTCATCACTTATCACAACTCGAGTTGTGATAAGTGATGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005548.2-258s21c1
Sequence:CCGGCGTGGACCCAAATCAATACTACTCGAGTAGTATTGATTTGGGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005548.2-1401s21c1
Sequence:CCGGCCTGGAAGTGACTTGCATCAACTCGAGTTGATGCAAGTCACTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005548.2-891s21c1
Sequence:CCGGGCCTTTCATCACTTATCACAACTCGAGTTGTGATAAGTGATGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005548.2-732s21c1
Sequence:CCGGCCAGAGATACTTGGACTTGATCTCGAGATCAAGTCCAAGTATCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)