EMAIL THIS PAGE TO A FRIEND

KAT2B

K(lysine) acetyltransferase 2B

189 Gene Product Result for
Synonyms: CAF P P/CAF PCAF
UniProtKB ID: Q92831, Q6NSK1
Gene ID:
Human(8850) Summary: CBP and p300 are large nuclear proteins that bind to many sequence-specific factors involved in cell growth and/or differentiation, including c-jun and the adenoviral oncoprotein E1A. The protein encoded by this gene associates with p300/CBP. It has in vitro and in vivo binding activity with CBP and p300, and competes with E1A for binding sites in p300/CBP. It has histone acetyl transferase activity with core histones and nucleosome core particles, indicating that this protein plays a direct role in transcriptional regulation. [provided by RefSeq, Jul 2008]
Mouse(18519) K(lysine) acetyltransferase 2B
domestic guinea pig(100719014) K(lysine) acetyltransferase 2B
naked mole-rat(101711015) K(lysine) acetyltransferase 2B
sheep(101115756) K(lysine) acetyltransferase 2B
Zebrafish(563942) K(lysine) acetyltransferase 2B
domestic cat(101080732) K(lysine) acetyltransferase 2B
Horse(100061976) K(lysine) acetyltransferase 2B
cow(407215) K(lysine) acetyltransferase 2B
dog(477052) K(lysine) acetyltransferase 2B
chicken(428441) K(lysine) acetyltransferase 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA055839 Anti-KAT2B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4503485 Anti-p300 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
P7493 Anti-PCAF antibody produced in rabbit affinity isolated antibody, buffered aqueous solution canine, human
immunoprecipitation (IP), microarray, western blot pricing
AV32466 Anti-PCAF antibody produced in rabbit IgG fraction of antiserum mouse, rat, guinea pig, dog, human, bovine, rabbit, horse
western blot pricing
SAB2101734 Anti-PCAF antibody produced in rabbit affinity isolated antibody human
western blot pricing
P2859 Monoclonal Anti-p300/CBP antibody produced in mouse clone NM11, purified from hybridoma cell culture human, mink, rat, monkey, mouse
immunocytochemistry, immunoprecipitation (IP), microarray, western blot pricing
WH0008850M2 Monoclonal Anti-PCAF antibody produced in mouse clone 1H2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404637 Monoclonal Anti-PCAF antibody produced in mouse clone 5E11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409953 Monoclonal Anti-PCAF antibody produced in mouse clone 5E5, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, immunofluorescence, western blot pricing
SAB1409954 Monoclonal Anti-PCAF antibody produced in mouse clone 4C10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409955 Monoclonal Anti-PCAF antibody produced in mouse clone 4D11, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

Small Molecule - Cofactor

Product # Description Species Add to Cart
 
A2181 Acetyl coenzyme A lithium salt ≥93% (HPLC) human, mouse, rat pricing
A2056 Acetyl coenzyme A sodium salt ≥93% (HPLC), powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020005 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020005 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020005 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003884 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003884 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003884 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003884 Rosetta Predictions human pricing
NM_020005 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100381 predicted 1463
2 SASI_Hs01_00100382 predicted 1332
3 SASI_Hs01_00100383 predicted 978
4 SASI_Hs01_00100385 predicted 1802
5 SASI_Hs01_00100386 predicted 1166
6 SASI_Hs01_00100387 predicted 1497
7 SASI_Hs02_00336494 predicted 2138
8 SASI_Hs01_00100390 predicted 1021
9 SASI_Hs02_00336495 predicted 1793
10 SASI_Hs02_00336496 predicted 2342
11 SASI_Hs01_00100384 predicted 1011
12 SASI_Hs01_00100388 predicted 2280
13 SASI_Hs01_00100389 predicted 1583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020005 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043888 predicted 506
2 SASI_Mm02_00325365 predicted 1046
3 SASI_Mm02_00325366 predicted 1130
4 SASI_Mm02_00325367 predicted 2176
5 SASI_Mm02_00325368 predicted 2217
6 SASI_Mm02_00325369 predicted 625
7 SASI_Mm01_00043891 predicted 1105
8 SASI_Mm02_00325370 predicted 1014
9 SASI_Mm01_00043892 predicted 533
10 SASI_Mm02_00325371 predicted 525
11 SASI_Mm01_00043889 predicted 606
12 SASI_Mm01_00043890 predicted 1295
13 SASI_Mm01_00043893 predicted 445
14 SASI_Mm01_00043894 predicted 2181
15 SASI_Mm01_00043895 predicted 1223
16 SASI_Mm01_00043896 predicted 686
17 SASI_Mm01_00043897 predicted 512
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020005
VALIDATED
KAT2B MISSION shRNA Bacterial Glycerol Stock
K(lysine) acetyltransferase 2B
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020005.1-962s1c1
Sequence:CCGGGCACGCTTATCCTCACACATTCTCGAGAATGTGTGAGGATAAGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020005.3-337s21c1
Sequence:CCGGCAGCAGATAATTGTCAGTTTGCTCGAGCAAACTGACAATTATCTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020005.3-3940s21c1
Sequence:CCGGAGTGGTATCTAGACTATTAATCTCGAGATTAATAGTCTAGATACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020005.3-1095s21c1
Sequence:GTACCGGGCTAGGAATCCAAACAGTAATCTCGAGATTACTGTTTGGATTCCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020005.1-2154s1c1
Sequence:CCGGGCAGGTGAAGAACCATCCAAACTCGAGTTTGGATGGTTCTTCACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020005.1-1094s1c1
Sequence:CCGGCAGTAATCAGTCCTCCTGTTACTCGAGTAACAGGAGGACTGATTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020005.1-2215s1c1
Sequence:CCGGCCGGGATATTATGAAGTTATACTCGAGTATAACTTCATAATATCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020005.1-950s1c1
Sequence:CCGGCTCTTGAGAAACGCACGCTTACTCGAGTAAGCGTGCGTTTCTCAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020005.3-2370s21c1
Sequence:CCGGTCCCGAGAGCGAGTACTACAACTCGAGTTGTAGTACTCGCTCTCGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020005.3-966s21c1
Sequence:CCGGTCTTGAGAAACGCACGCTTATCTCGAGATAAGCGTGCGTTTCTCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020005.3-1788s21c1
Sequence:CCGGTGAGTATGCCATCGGCTATTTCTCGAGAAATAGCCGATGGCATACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020005.3-2784s21c1
Sequence:CCGGTTGCACACAGTACCAAGATTTCTCGAGAAATCTTGGTACTGTGTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020005.3-2855s21c1
Sequence:CCGGATGGAACATGAGAGTTTATTTCTCGAGAAATAAACTCTCATGTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020005
VALIDATED
KAT2B MISSION shRNA shRNA Plasmid DNA
K(lysine) acetyltransferase 2B
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020005.1-962s1c1
Sequence:CCGGGCACGCTTATCCTCACACATTCTCGAGAATGTGTGAGGATAAGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020005.3-337s21c1
Sequence:CCGGCAGCAGATAATTGTCAGTTTGCTCGAGCAAACTGACAATTATCTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020005.3-3940s21c1
Sequence:CCGGAGTGGTATCTAGACTATTAATCTCGAGATTAATAGTCTAGATACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020005.3-1095s21c1
Sequence:GTACCGGGCTAGGAATCCAAACAGTAATCTCGAGATTACTGTTTGGATTCCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020005.1-2154s1c1
Sequence:CCGGGCAGGTGAAGAACCATCCAAACTCGAGTTTGGATGGTTCTTCACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020005.1-1094s1c1
Sequence:CCGGCAGTAATCAGTCCTCCTGTTACTCGAGTAACAGGAGGACTGATTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020005.1-2215s1c1
Sequence:CCGGCCGGGATATTATGAAGTTATACTCGAGTATAACTTCATAATATCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020005.1-950s1c1
Sequence:CCGGCTCTTGAGAAACGCACGCTTACTCGAGTAAGCGTGCGTTTCTCAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020005.3-2370s21c1
Sequence:CCGGTCCCGAGAGCGAGTACTACAACTCGAGTTGTAGTACTCGCTCTCGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020005.3-966s21c1
Sequence:CCGGTCTTGAGAAACGCACGCTTATCTCGAGATAAGCGTGCGTTTCTCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020005.3-1788s21c1
Sequence:CCGGTGAGTATGCCATCGGCTATTTCTCGAGAAATAGCCGATGGCATACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020005.3-2784s21c1
Sequence:CCGGTTGCACACAGTACCAAGATTTCTCGAGAAATCTTGGTACTGTGTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020005.3-2855s21c1
Sequence:CCGGATGGAACATGAGAGTTTATTTCTCGAGAAATAAACTCTCATGTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020005
VALIDATED
KAT2B MISSION shRNA Lentiviral Transduction Particles
K(lysine) acetyltransferase 2B
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020005.1-962s1c1
Sequence:CCGGGCACGCTTATCCTCACACATTCTCGAGAATGTGTGAGGATAAGCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020005.3-337s21c1
Sequence:CCGGCAGCAGATAATTGTCAGTTTGCTCGAGCAAACTGACAATTATCTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020005.3-3940s21c1
Sequence:CCGGAGTGGTATCTAGACTATTAATCTCGAGATTAATAGTCTAGATACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020005.3-1095s21c1
Sequence:GTACCGGGCTAGGAATCCAAACAGTAATCTCGAGATTACTGTTTGGATTCCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020005.1-2154s1c1
Sequence:CCGGGCAGGTGAAGAACCATCCAAACTCGAGTTTGGATGGTTCTTCACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020005.1-1094s1c1
Sequence:CCGGCAGTAATCAGTCCTCCTGTTACTCGAGTAACAGGAGGACTGATTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020005.1-2215s1c1
Sequence:CCGGCCGGGATATTATGAAGTTATACTCGAGTATAACTTCATAATATCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020005.1-950s1c1
Sequence:CCGGCTCTTGAGAAACGCACGCTTACTCGAGTAAGCGTGCGTTTCTCAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020005.3-2370s21c1
Sequence:CCGGTCCCGAGAGCGAGTACTACAACTCGAGTTGTAGTACTCGCTCTCGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020005.3-966s21c1
Sequence:CCGGTCTTGAGAAACGCACGCTTATCTCGAGATAAGCGTGCGTTTCTCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020005.3-1788s21c1
Sequence:CCGGTGAGTATGCCATCGGCTATTTCTCGAGAAATAGCCGATGGCATACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020005.3-2784s21c1
Sequence:CCGGTTGCACACAGTACCAAGATTTCTCGAGAAATCTTGGTACTGTGTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020005.3-2855s21c1
Sequence:CCGGATGGAACATGAGAGTTTATTTCTCGAGAAATAAACTCTCATGTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003884
VALIDATED
KAT2B MISSION shRNA Bacterial Glycerol Stock
K(lysine) acetyltransferase 2B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003884.3-1617s1c1
Sequence:CCGGGCTGGGACAATTTCATACAATCTCGAGATTGTATGAAATTGTCCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003884.4-3192s21c1
Sequence:CCGGTGGCATGTCCATTAGCTATTTCTCGAGAAATAGCTAATGGACATGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_003884.3-987s1c1
Sequence:CCGGGCAGATACCAAACAAGTTTATCTCGAGATAAACTTGTTTGGTATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003884.4-2379s21c1
Sequence:CCGGTTAATGGGATGTGAGCTAAATCTCGAGATTTAGCTCACATCCCATTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_003884.3-2814s1c1
Sequence:CCGGGCAGACTTACAGCGAGTCTTTCTCGAGAAAGACTCGCTGTAAGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_003884.3-1461s1c1
Sequence:CCGGCGAACTCTAATCCTCACTCATCTCGAGATGAGTGAGGATTAGAGTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003884.3-2346s1c1
Sequence:CCGGGTTGGCTATATCAAGGATTATCTCGAGATAATCCTTGATATAGCCAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003884.4-1199s21c1
Sequence:CCGGCCTAAACCGCATCAACTATTGCTCGAGCAATAGTTGATGCGGTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003884
VALIDATED
KAT2B MISSION shRNA shRNA Plasmid DNA
K(lysine) acetyltransferase 2B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003884.3-1617s1c1
Sequence:CCGGGCTGGGACAATTTCATACAATCTCGAGATTGTATGAAATTGTCCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003884.4-3192s21c1
Sequence:CCGGTGGCATGTCCATTAGCTATTTCTCGAGAAATAGCTAATGGACATGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_003884.3-987s1c1
Sequence:CCGGGCAGATACCAAACAAGTTTATCTCGAGATAAACTTGTTTGGTATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003884.4-2379s21c1
Sequence:CCGGTTAATGGGATGTGAGCTAAATCTCGAGATTTAGCTCACATCCCATTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_003884.3-2814s1c1
Sequence:CCGGGCAGACTTACAGCGAGTCTTTCTCGAGAAAGACTCGCTGTAAGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_003884.3-1461s1c1
Sequence:CCGGCGAACTCTAATCCTCACTCATCTCGAGATGAGTGAGGATTAGAGTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003884.3-2346s1c1
Sequence:CCGGGTTGGCTATATCAAGGATTATCTCGAGATAATCCTTGATATAGCCAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003884.4-1199s21c1
Sequence:CCGGCCTAAACCGCATCAACTATTGCTCGAGCAATAGTTGATGCGGTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003884
VALIDATED
KAT2B MISSION shRNA Lentiviral Transduction Particles
K(lysine) acetyltransferase 2B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003884.3-1617s1c1
Sequence:CCGGGCTGGGACAATTTCATACAATCTCGAGATTGTATGAAATTGTCCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003884.4-3192s21c1
Sequence:CCGGTGGCATGTCCATTAGCTATTTCTCGAGAAATAGCTAATGGACATGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_003884.3-987s1c1
Sequence:CCGGGCAGATACCAAACAAGTTTATCTCGAGATAAACTTGTTTGGTATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003884.4-2379s21c1
Sequence:CCGGTTAATGGGATGTGAGCTAAATCTCGAGATTTAGCTCACATCCCATTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_003884.3-2814s1c1
Sequence:CCGGGCAGACTTACAGCGAGTCTTTCTCGAGAAAGACTCGCTGTAAGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_003884.3-1461s1c1
Sequence:CCGGCGAACTCTAATCCTCACTCATCTCGAGATGAGTGAGGATTAGAGTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003884.3-2346s1c1
Sequence:CCGGGTTGGCTATATCAAGGATTATCTCGAGATAATCCTTGATATAGCCAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003884.4-1199s21c1
Sequence:CCGGCCTAAACCGCATCAACTATTGCTCGAGCAATAGTTGATGCGGTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)