EMAIL THIS PAGE TO A FRIEND

KAT6A

K(lysine) acetyltransferase 6A

192 Gene Product Result for
Synonyms: MOZ MYST3 RUNXBP2 ZC2HC6A ZNF220
UniProtKB ID: Q92794, Q76L81
Gene ID:
Mouse(244349) K(lysine) acetyltransferase 6A
Rat(306571) K(lysine) acetyltransferase 6A
Zebrafish(266966) K(lysine) acetyltransferase 6A
dog(100683464) K(lysine) acetyltransferase 6A
chicken(426789) K(lysine) acetyltransferase 6A
cow(529373) K(lysine) acetyltransferase 6A
sheep(101121826) K(lysine) acetyltransferase 6A
domestic guinea pig(100725552) K(lysine) acetyltransferase 6A
naked mole-rat(101713625) K(lysine) acetyltransferase 6A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006766 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006766 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006766 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081149 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081149 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081149 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_146248 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_146248 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_146248 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099412 Rosetta Predictions human pricing
NM_001099413 Rosetta Predictions human pricing
NM_006766 Rosetta Predictions human pricing
XM_001063777 Rosetta Predictions rat pricing
XM_225008 Rosetta Predictions rat pricing
NM_001081149 Rosetta Predictions mouse pricing
XM_146248 Rosetta Predictions mouse pricing
XM_985067 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320649 predicted 4747
2 SASI_Hs02_00320650 predicted 4986
3 SASI_Hs02_00320651 predicted 1694
4 SASI_Hs02_00320652 predicted 763
5 SASI_Hs02_00320653 predicted 5207
6 SASI_Hs02_00320654 predicted 5132
7 SASI_Hs02_00320655 predicted 4962
8 SASI_Hs02_00320656 predicted 2627
9 SASI_Hs02_00320657 predicted 3628
10 SASI_Hs02_00320658 predicted 3834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320659 predicted 4702
2 SASI_Hs02_00320660 predicted 4938
3 SASI_Hs02_00320661 predicted 1652
4 SASI_Hs02_00320662 predicted 718
5 SASI_Hs02_00320663 predicted 5088
6 SASI_Hs02_00320664 predicted 4927
7 SASI_Hs02_00320665 predicted 2591
8 SASI_Hs02_00320666 predicted 3586
9 SASI_Hs02_00320667 predicted 3786
10 SASI_Hs02_00320668 predicted 3768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089741 predicted 4607
2 SASI_Hs01_00089742 predicted 4847
3 SASI_Hs01_00089743 predicted 1559
4 SASI_Hs01_00089744 predicted 626
5 SASI_Hs01_00089745 predicted 5006
6 SASI_Hs01_00089747 predicted 4835
7 SASI_Hs02_00342270 predicted 2502
8 SASI_Hs01_00089749 predicted 3492
9 SASI_Hs02_00342271 predicted 3700
10 SASI_Hs02_00342272 predicted 3682
11 SASI_Hs01_00089740 predicted 819
12 SASI_Hs01_00089746 predicted 5892
13 SASI_Hs01_00089748 predicted 3571
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308281 predicted 4826
2 SASI_Rn02_00308282 predicted 2876
3 SASI_Rn02_00308283 predicted 624
4 SASI_Rn02_00308284 predicted 2533
5 SASI_Rn02_00308285 predicted 4985
6 SASI_Rn02_00308286 predicted 1532
7 SASI_Rn02_00308287 predicted 3381
8 SASI_Rn02_00308288 predicted 1548
9 SASI_Rn02_00308289 predicted 4780
10 SASI_Rn02_00308290 predicted 6268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382437 predicted 4828
2 SASI_Rn02_00382438 predicted 2880
3 SASI_Rn02_00382439 predicted 631
4 SASI_Rn02_00382440 predicted 2534
5 SASI_Rn02_00382441 predicted 4980
6 SASI_Rn02_00382442 predicted 1532
7 SASI_Rn02_00382443 predicted 3379
8 SASI_Rn02_00382444 predicted 1546
9 SASI_Rn02_00382445 predicted 4784
10 SASI_Rn02_00382446 predicted 6275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295661 predicted 2834
2 SASI_Mm02_00295662 predicted 5070
3 SASI_Mm02_00295663 predicted 1710
4 SASI_Mm02_00295664 predicted 3004
5 SASI_Mm02_00295665 predicted 1633
6 SASI_Mm02_00295666 predicted 2991
7 SASI_Mm02_00295667 predicted 4109
8 SASI_Mm02_00295668 predicted 4669
9 SASI_Mm02_00295669 predicted 2279
10 SASI_Mm02_00295670 predicted 1545
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_146248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258875 predicted 6372
2 SASI_Mm01_00258876 predicted 2839
3 SASI_Mm01_00258877 predicted 5069
4 SASI_Mm01_00258878 predicted 3005
5 SASI_Mm01_00258879 predicted 1637
6 SASI_Mm01_00258880 predicted 2989
7 SASI_Mm01_00258881 predicted 4122
8 SASI_Mm01_00258882 predicted 1419
9 SASI_Mm01_00258883 predicted 4675
10 SASI_Mm01_00258884 predicted 2280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_985067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272868 predicted 2832
2 SASI_Mm01_00272869 predicted 5074
3 SASI_Mm01_00272870 predicted 3010
4 SASI_Mm01_00272871 predicted 1640
5 SASI_Mm01_00272872 predicted 2995
6 SASI_Mm01_00272873 predicted 4115
7 SASI_Mm01_00272874 predicted 1411
8 SASI_Mm01_00272875 predicted 4682
9 SASI_Mm01_00272876 predicted 2283
10 SASI_Mm01_00272877 predicted 1546
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006766
VALIDATED
KAT6A MISSION shRNA Bacterial Glycerol Stock
K(lysine) acetyltransferase 6A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006766.1-7352s1c1
Sequence:CCGGGCCTCTTGTTTCTAGTATGTACTCGAGTACATACTAGAAACAAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006766.1-3963s1c1
Sequence:CCGGGCCCATCGTTTCCATTCCTAACTCGAGTTAGGAATGGAAACGATGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006766.1-5738s1c1
Sequence:CCGGCCAGTGTTTCTCTGTCCAATACTCGAGTATTGGACAGAGAAACACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006766.1-1378s1c1
Sequence:CCGGCGGCGCTATACTAATCCAATACTCGAGTATTGGATTAGTATAGCGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_006766.3-3759s21c1
Sequence:CCGGCTGATGACACTCCTATCTTAACTCGAGTTAAGATAGGAGTGTCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006766.1-4592s1c1
Sequence:CCGGCCCACACTAAGGAAGAGTTAACTCGAGTTAACTCTTCCTTAGTGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006766.3-5513s21c1
Sequence:CCGGCCGCTGTCACAGTGTAGTATGCTCGAGCATACTACACTGTGACAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006766.3-1397s21c1
Sequence:CCGGCGGCGCTATACTAATCCAATACTCGAGTATTGGATTAGTATAGCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_006766.3-3960s21c1
Sequence:GTACCGGCTACTCAAGCATGCGTCATTGCTCGAGCAATGACGCATGCTTGAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006766.3-849s21c1
Sequence:GTACCGGAGTTACGATTGGCTATCAAACCTCGAGGTTTGATAGCCAATCGTAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006766.3-2158s21c1
Sequence:GTACCGGTGGGAATGTGAGTACCATTTACTCGAGTAAATGGTACTCACATTCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006766.3-6122s21c1
Sequence:CCGGATGCCTACTCCCGCCTATAATCTCGAGATTATAGGCGGGAGTAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006766.3-6735s21c1
Sequence:CCGGCATACCACATGGACAGAATTTCTCGAGAAATTCTGTCCATGTGGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006766
VALIDATED
KAT6A MISSION shRNA shRNA Plasmid DNA
K(lysine) acetyltransferase 6A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006766.1-7352s1c1
Sequence:CCGGGCCTCTTGTTTCTAGTATGTACTCGAGTACATACTAGAAACAAGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006766.1-3963s1c1
Sequence:CCGGGCCCATCGTTTCCATTCCTAACTCGAGTTAGGAATGGAAACGATGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006766.1-5738s1c1
Sequence:CCGGCCAGTGTTTCTCTGTCCAATACTCGAGTATTGGACAGAGAAACACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006766.1-1378s1c1
Sequence:CCGGCGGCGCTATACTAATCCAATACTCGAGTATTGGATTAGTATAGCGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_006766.3-3759s21c1
Sequence:CCGGCTGATGACACTCCTATCTTAACTCGAGTTAAGATAGGAGTGTCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006766.1-4592s1c1
Sequence:CCGGCCCACACTAAGGAAGAGTTAACTCGAGTTAACTCTTCCTTAGTGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006766.3-5513s21c1
Sequence:CCGGCCGCTGTCACAGTGTAGTATGCTCGAGCATACTACACTGTGACAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006766.3-1397s21c1
Sequence:CCGGCGGCGCTATACTAATCCAATACTCGAGTATTGGATTAGTATAGCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_006766.3-3960s21c1
Sequence:GTACCGGCTACTCAAGCATGCGTCATTGCTCGAGCAATGACGCATGCTTGAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006766.3-849s21c1
Sequence:GTACCGGAGTTACGATTGGCTATCAAACCTCGAGGTTTGATAGCCAATCGTAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006766.3-2158s21c1
Sequence:GTACCGGTGGGAATGTGAGTACCATTTACTCGAGTAAATGGTACTCACATTCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006766.3-6122s21c1
Sequence:CCGGATGCCTACTCCCGCCTATAATCTCGAGATTATAGGCGGGAGTAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006766.3-6735s21c1
Sequence:CCGGCATACCACATGGACAGAATTTCTCGAGAAATTCTGTCCATGTGGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006766
VALIDATED
KAT6A MISSION shRNA Lentiviral Transduction Particles
K(lysine) acetyltransferase 6A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006766.1-7352s1c1
Sequence:CCGGGCCTCTTGTTTCTAGTATGTACTCGAGTACATACTAGAAACAAGAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006766.1-3963s1c1
Sequence:CCGGGCCCATCGTTTCCATTCCTAACTCGAGTTAGGAATGGAAACGATGGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006766.1-5738s1c1
Sequence:CCGGCCAGTGTTTCTCTGTCCAATACTCGAGTATTGGACAGAGAAACACTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006766.1-1378s1c1
Sequence:CCGGCGGCGCTATACTAATCCAATACTCGAGTATTGGATTAGTATAGCGCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_006766.3-3759s21c1
Sequence:CCGGCTGATGACACTCCTATCTTAACTCGAGTTAAGATAGGAGTGTCATCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006766.1-4592s1c1
Sequence:CCGGCCCACACTAAGGAAGAGTTAACTCGAGTTAACTCTTCCTTAGTGTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006766.3-5513s21c1
Sequence:CCGGCCGCTGTCACAGTGTAGTATGCTCGAGCATACTACACTGTGACAGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006766.3-1397s21c1
Sequence:CCGGCGGCGCTATACTAATCCAATACTCGAGTATTGGATTAGTATAGCGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_006766.3-3960s21c1
Sequence:GTACCGGCTACTCAAGCATGCGTCATTGCTCGAGCAATGACGCATGCTTGAGTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006766.3-849s21c1
Sequence:GTACCGGAGTTACGATTGGCTATCAAACCTCGAGGTTTGATAGCCAATCGTAACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006766.3-2158s21c1
Sequence:GTACCGGTGGGAATGTGAGTACCATTTACTCGAGTAAATGGTACTCACATTCCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006766.3-6122s21c1
Sequence:CCGGATGCCTACTCCCGCCTATAATCTCGAGATTATAGGCGGGAGTAGGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006766.3-6735s21c1
Sequence:CCGGCATACCACATGGACAGAATTTCTCGAGAAATTCTGTCCATGTGGTATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081149
KAT6A MISSION shRNA Bacterial Glycerol Stock
K(lysine) acetyltransferase 6A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081149.1-6201s21c1
Sequence:CCGGATGCCCACTCCAGCCTATAATCTCGAGATTATAGGCTGGAGTGGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081149.1-655s21c1
Sequence:CCGGGCGTCAAAGACGGGACGATTTCTCGAGAAATCGTCCCGTCTTTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081149.1-8575s21c1
Sequence:CCGGATTATCCAACACGGTAATATTCTCGAGAATATTACCGTGTTGGATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081149.1-2081s21c1
Sequence:CCGGGTACTCAAGGCTGCCTAAATTCTCGAGAATTTAGGCAGCCTTGAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081149.1-3669s21c1
Sequence:CCGGCCACGACTGGAGCCTACATTTCTCGAGAAATGTAGGCTCCAGTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081149
KAT6A MISSION shRNA shRNA Plasmid DNA
K(lysine) acetyltransferase 6A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081149.1-6201s21c1
Sequence:CCGGATGCCCACTCCAGCCTATAATCTCGAGATTATAGGCTGGAGTGGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081149.1-655s21c1
Sequence:CCGGGCGTCAAAGACGGGACGATTTCTCGAGAAATCGTCCCGTCTTTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081149.1-8575s21c1
Sequence:CCGGATTATCCAACACGGTAATATTCTCGAGAATATTACCGTGTTGGATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081149.1-2081s21c1
Sequence:CCGGGTACTCAAGGCTGCCTAAATTCTCGAGAATTTAGGCAGCCTTGAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081149.1-3669s21c1
Sequence:CCGGCCACGACTGGAGCCTACATTTCTCGAGAAATGTAGGCTCCAGTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081149
KAT6A MISSION shRNA Lentiviral Transduction Particles
K(lysine) acetyltransferase 6A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081149.1-6201s21c1
Sequence:CCGGATGCCCACTCCAGCCTATAATCTCGAGATTATAGGCTGGAGTGGGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081149.1-655s21c1
Sequence:CCGGGCGTCAAAGACGGGACGATTTCTCGAGAAATCGTCCCGTCTTTGACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081149.1-8575s21c1
Sequence:CCGGATTATCCAACACGGTAATATTCTCGAGAATATTACCGTGTTGGATAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081149.1-2081s21c1
Sequence:CCGGGTACTCAAGGCTGCCTAAATTCTCGAGAATTTAGGCAGCCTTGAGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081149.1-3669s21c1
Sequence:CCGGCCACGACTGGAGCCTACATTTCTCGAGAAATGTAGGCTCCAGTCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_146248
VALIDATED
KAT6A MISSION shRNA Bacterial Glycerol Stock
K(lysine) acetyltransferase 6A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_146248.5-3569s1c1
Sequence:CCGGGCAAGCGGAAACACCACAATACTCGAGTATTGTGGTGTTTCCGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146248.5-1205s1c1
Sequence:CCGGGCGGTCATCCATCGTGTTTAACTCGAGTTAAACACGATGGATGACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146248.5-6054s1c1
Sequence:CCGGGCACATTTCTATCCGTTCCAACTCGAGTTGGAACGGATAGAAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146248.5-1690s1c1
Sequence:CCGGCCCTTGAAGTTCAACAAGAAACTCGAGTTTCTTGTTGAACTTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146248.5-2714s1c1
Sequence:CCGGGCAGTGACCAATTTGTGATTACTCGAGTAATCACAAATTGGTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_146248
VALIDATED
KAT6A MISSION shRNA shRNA Plasmid DNA
K(lysine) acetyltransferase 6A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_146248.5-3569s1c1
Sequence:CCGGGCAAGCGGAAACACCACAATACTCGAGTATTGTGGTGTTTCCGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146248.5-1205s1c1
Sequence:CCGGGCGGTCATCCATCGTGTTTAACTCGAGTTAAACACGATGGATGACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146248.5-6054s1c1
Sequence:CCGGGCACATTTCTATCCGTTCCAACTCGAGTTGGAACGGATAGAAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146248.5-1690s1c1
Sequence:CCGGCCCTTGAAGTTCAACAAGAAACTCGAGTTTCTTGTTGAACTTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146248.5-2714s1c1
Sequence:CCGGGCAGTGACCAATTTGTGATTACTCGAGTAATCACAAATTGGTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_146248
VALIDATED
KAT6A MISSION shRNA Lentiviral Transduction Particles
K(lysine) acetyltransferase 6A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_146248.5-3569s1c1
Sequence:CCGGGCAAGCGGAAACACCACAATACTCGAGTATTGTGGTGTTTCCGCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146248.5-1205s1c1
Sequence:CCGGGCGGTCATCCATCGTGTTTAACTCGAGTTAAACACGATGGATGACCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146248.5-6054s1c1
Sequence:CCGGGCACATTTCTATCCGTTCCAACTCGAGTTGGAACGGATAGAAATGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146248.5-1690s1c1
Sequence:CCGGCCCTTGAAGTTCAACAAGAAACTCGAGTTTCTTGTTGAACTTCAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_146248.5-2714s1c1
Sequence:CCGGGCAGTGACCAATTTGTGATTACTCGAGTAATCACAAATTGGTCACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)