EMAIL THIS PAGE TO A FRIEND

KAT6B

K(lysine) acetyltransferase 6B

113 Gene Product Result for
Synonyms: GTPTS MORF MOZ2 MYST4 ZC2HC6B qkf querkopf
Gene ID:
Human(23522) Summary: The protein encoded by this gene is a histone acetyltransferase and component of the MOZ/MORF protein complex. In addition to its acetyltransferase activity, the encoded protein has transcriptional activation activity in its N-terminal end and transcriptional repression activity in its C-terminal end. This protein is necessary for RUNX2-dependent transcriptional activation and could be involved in brain development. Mutations have been found in patients with genitopatellar syndrome. A translocation of this gene and the CREBBP gene results in acute myeloid leukemias. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
Mouse(54169) K(lysine) acetyltransferase 6B
domestic guinea pig(100723383) K(lysine) acetyltransferase 6B
naked mole-rat(101720761) K(lysine) acetyltransferase 6B
sheep(101123266) K(lysine) acetyltransferase 6B
Zebrafish(568932) K(lysine) acetyltransferase 6B
chicken(423734) K(lysine) acetyltransferase 6B
dog(479254) K(lysine) acetyltransferase 6B
cow(535403) K(lysine) acetyltransferase 6B
domestic cat(101090801) K(lysine) acetyltransferase 6B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA006104 Anti-KAT6B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV38985 Anti-MyST4 antibody produced in rabbit affinity isolated antibody mouse, rabbit, horse, guinea pig, human, zebrafish, canine, bovine, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017479 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017479 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017479 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012330 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012330 Rosetta Predictions human pricing
NM_017479 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095664 predicted 2796
2 SASI_Hs01_00095665 predicted 4186
3 SASI_Hs01_00095666 predicted 779
4 SASI_Hs02_00344120 predicted 6176
5 SASI_Hs01_00095667 predicted 711
6 SASI_Hs01_00095668 predicted 5861
7 SASI_Hs02_00344121 predicted 4234
8 SASI_Hs01_00095669 predicted 2195
9 SASI_Hs01_00095670 predicted 5863
10 SASI_Hs01_00095673 predicted 3374
11 SASI_Hs01_00095671 predicted 6470
12 SASI_Hs01_00095672 predicted 5438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323947 predicted 2108
2 SASI_Mm02_00323948 predicted 1931
3 SASI_Mm02_00323949 predicted 4896
4 SASI_Mm02_00323950 predicted 4981
5 SASI_Mm02_00323951 predicted 4096
6 SASI_Mm02_00323952 predicted 4791
7 SASI_Mm02_00323953 predicted 2337
8 SASI_Mm02_00323954 predicted 4433
9 SASI_Mm02_00323955 predicted 4992
10 SASI_Mm02_00323956 predicted 650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017479
VALIDATED
KAT6B MISSION shRNA Bacterial Glycerol Stock
K(lysine) acetyltransferase 6B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017479.2-1468s21c1
Sequence:CCGGGGTCACCTGATACTGATATTACTCGAGTAATATCAGTATCAGGTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017479.2-2787s21c1
Sequence:CCGGCCACAGTCAGTTTCCATTAAACTCGAGTTTAATGGAAACTGACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017479.2-4980s21c1
Sequence:CCGGCCATTAAGTAACACAGGGCTTCTCGAGAAGCCCTGTGTTACTTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017479.2-1697s21c1
Sequence:CCGGCCCACAGGAATATGCAAGATTCTCGAGAATCTTGCATATTCCTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017479.2-5937s21c1
Sequence:CCGGGTCGTGCCTGCTTCCATTAAACTCGAGTTTAATGGAAGCAGGCACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017479.1-636s1c1
Sequence:CCGGCCGTGTAATGATCTACGCAATCTCGAGATTGCGTAGATCATTACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017479.1-2772s1c1
Sequence:CCGGCCACAGTCAGTTTCCATTAAACTCGAGTTTAATGGAAACTGACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017479.1-1213s1c1
Sequence:CCGGCCTGTGATAGAGGATTCCATACTCGAGTATGGAATCCTCTATCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017479.1-4965s1c1
Sequence:CCGGCCATTAAGTAACACAGGGCTTCTCGAGAAGCCCTGTGTTACTTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017479.1-1682s1c1
Sequence:CCGGCCCACAGGAATATGCAAGATTCTCGAGAATCTTGCATATTCCTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017479
VALIDATED
KAT6B MISSION shRNA shRNA Plasmid DNA
K(lysine) acetyltransferase 6B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017479.2-1468s21c1
Sequence:CCGGGGTCACCTGATACTGATATTACTCGAGTAATATCAGTATCAGGTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017479.2-2787s21c1
Sequence:CCGGCCACAGTCAGTTTCCATTAAACTCGAGTTTAATGGAAACTGACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017479.2-4980s21c1
Sequence:CCGGCCATTAAGTAACACAGGGCTTCTCGAGAAGCCCTGTGTTACTTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017479.2-1697s21c1
Sequence:CCGGCCCACAGGAATATGCAAGATTCTCGAGAATCTTGCATATTCCTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017479.2-5937s21c1
Sequence:CCGGGTCGTGCCTGCTTCCATTAAACTCGAGTTTAATGGAAGCAGGCACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017479.1-636s1c1
Sequence:CCGGCCGTGTAATGATCTACGCAATCTCGAGATTGCGTAGATCATTACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017479.1-2772s1c1
Sequence:CCGGCCACAGTCAGTTTCCATTAAACTCGAGTTTAATGGAAACTGACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017479.1-1213s1c1
Sequence:CCGGCCTGTGATAGAGGATTCCATACTCGAGTATGGAATCCTCTATCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017479.1-4965s1c1
Sequence:CCGGCCATTAAGTAACACAGGGCTTCTCGAGAAGCCCTGTGTTACTTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017479.1-1682s1c1
Sequence:CCGGCCCACAGGAATATGCAAGATTCTCGAGAATCTTGCATATTCCTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017479
VALIDATED
KAT6B MISSION shRNA Lentiviral Transduction Particles
K(lysine) acetyltransferase 6B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017479.2-1468s21c1
Sequence:CCGGGGTCACCTGATACTGATATTACTCGAGTAATATCAGTATCAGGTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017479.2-2787s21c1
Sequence:CCGGCCACAGTCAGTTTCCATTAAACTCGAGTTTAATGGAAACTGACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017479.2-4980s21c1
Sequence:CCGGCCATTAAGTAACACAGGGCTTCTCGAGAAGCCCTGTGTTACTTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017479.2-1697s21c1
Sequence:CCGGCCCACAGGAATATGCAAGATTCTCGAGAATCTTGCATATTCCTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017479.2-5937s21c1
Sequence:CCGGGTCGTGCCTGCTTCCATTAAACTCGAGTTTAATGGAAGCAGGCACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017479.1-636s1c1
Sequence:CCGGCCGTGTAATGATCTACGCAATCTCGAGATTGCGTAGATCATTACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017479.1-2772s1c1
Sequence:CCGGCCACAGTCAGTTTCCATTAAACTCGAGTTTAATGGAAACTGACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017479.1-1213s1c1
Sequence:CCGGCCTGTGATAGAGGATTCCATACTCGAGTATGGAATCCTCTATCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017479.1-4965s1c1
Sequence:CCGGCCATTAAGTAACACAGGGCTTCTCGAGAAGCCCTGTGTTACTTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017479.1-1682s1c1
Sequence:CCGGCCCACAGGAATATGCAAGATTCTCGAGAATCTTGCATATTCCTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012330
VALIDATED
KAT6B MISSION shRNA Bacterial Glycerol Stock
K(lysine) acetyltransferase 6B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012330.2-1000s21c1
Sequence:CCGGACCGCAGTACAGGGTCAATTACTCGAGTAATTGACCCTGTACTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_012330.2-2450s21c1
Sequence:CCGGTTGACAGACGGAAGGATTAAACTCGAGTTTAATCCTTCCGTCTGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012330.2-7587s21c1
Sequence:CCGGATGGAAATGCCTCTAACTTTACTCGAGTAAAGTTAGAGGCATTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012330.2-4897s21c1
Sequence:CCGGCTCGAACCCAGAGGTCTTAATCTCGAGATTAAGACCTCTGGGTTCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012330.2-2267s21c1
Sequence:CCGGGATATTAGAAGTCGGTTTATTCTCGAGAATAAACCGACTTCTAATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012330.1-790s1c1
Sequence:CCGGGCTGTGAATAATGGGAGGTTACTCGAGTAACCTCCCATTATTCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012330.1-2017s1c1
Sequence:CCGGCCCAAACGTATGCGTCGTAAACTCGAGTTTACGACGCATACGTTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012330.1-6181s1c1
Sequence:CCGGGCACGGACTTTAACGATGCAACTCGAGTTGCATCGTTAAAGTCCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012330.1-1565s1c1
Sequence:CCGGCCACCTACATTTCTGCCTCTACTCGAGTAGAGGCAGAAATGTAGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012330.1-3969s1c1
Sequence:CCGGCCCTTGTAGAAACAATATGAACTCGAGTTCATATTGTTTCTACAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012330
VALIDATED
KAT6B MISSION shRNA shRNA Plasmid DNA
K(lysine) acetyltransferase 6B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012330.2-1000s21c1
Sequence:CCGGACCGCAGTACAGGGTCAATTACTCGAGTAATTGACCCTGTACTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_012330.2-2450s21c1
Sequence:CCGGTTGACAGACGGAAGGATTAAACTCGAGTTTAATCCTTCCGTCTGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012330.2-7587s21c1
Sequence:CCGGATGGAAATGCCTCTAACTTTACTCGAGTAAAGTTAGAGGCATTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012330.2-4897s21c1
Sequence:CCGGCTCGAACCCAGAGGTCTTAATCTCGAGATTAAGACCTCTGGGTTCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012330.2-2267s21c1
Sequence:CCGGGATATTAGAAGTCGGTTTATTCTCGAGAATAAACCGACTTCTAATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012330.1-790s1c1
Sequence:CCGGGCTGTGAATAATGGGAGGTTACTCGAGTAACCTCCCATTATTCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012330.1-2017s1c1
Sequence:CCGGCCCAAACGTATGCGTCGTAAACTCGAGTTTACGACGCATACGTTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012330.1-6181s1c1
Sequence:CCGGGCACGGACTTTAACGATGCAACTCGAGTTGCATCGTTAAAGTCCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012330.1-1565s1c1
Sequence:CCGGCCACCTACATTTCTGCCTCTACTCGAGTAGAGGCAGAAATGTAGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012330.1-3969s1c1
Sequence:CCGGCCCTTGTAGAAACAATATGAACTCGAGTTCATATTGTTTCTACAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012330
VALIDATED
KAT6B MISSION shRNA Lentiviral Transduction Particles
K(lysine) acetyltransferase 6B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012330.2-1000s21c1
Sequence:CCGGACCGCAGTACAGGGTCAATTACTCGAGTAATTGACCCTGTACTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_012330.2-2450s21c1
Sequence:CCGGTTGACAGACGGAAGGATTAAACTCGAGTTTAATCCTTCCGTCTGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012330.2-7587s21c1
Sequence:CCGGATGGAAATGCCTCTAACTTTACTCGAGTAAAGTTAGAGGCATTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012330.2-4897s21c1
Sequence:CCGGCTCGAACCCAGAGGTCTTAATCTCGAGATTAAGACCTCTGGGTTCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012330.2-2267s21c1
Sequence:CCGGGATATTAGAAGTCGGTTTATTCTCGAGAATAAACCGACTTCTAATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012330.1-790s1c1
Sequence:CCGGGCTGTGAATAATGGGAGGTTACTCGAGTAACCTCCCATTATTCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012330.1-2017s1c1
Sequence:CCGGCCCAAACGTATGCGTCGTAAACTCGAGTTTACGACGCATACGTTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012330.1-6181s1c1
Sequence:CCGGGCACGGACTTTAACGATGCAACTCGAGTTGCATCGTTAAAGTCCGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012330.1-1565s1c1
Sequence:CCGGCCACCTACATTTCTGCCTCTACTCGAGTAGAGGCAGAAATGTAGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012330.1-3969s1c1
Sequence:CCGGCCCTTGTAGAAACAATATGAACTCGAGTTCATATTGTTTCTACAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)