EMAIL THIS PAGE TO A FRIEND

KAT8

K(lysine) acetyltransferase 8

123 Gene Product Result for
Synonyms: MOF MYST1 ZC2HC8 hMOF
Gene ID:
Human(84148) Summary: This gene encodes a member of the MYST histone acetylase protein family. The encoded protein has a characteristic MYST domain containing an acetyl-CoA-binding site, a chromodomain typical of proteins which bind histones, and a C2HC-type zinc finger. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(67773) K(lysine) acetyltransferase 8
Rat(310194) K (lysine) acetyltransferase 8
domestic guinea pig(100718157) K(lysine) acetyltransferase 8
naked mole-rat(101715024) K(lysine) acetyltransferase 8
sheep(101104546) K(lysine) acetyltransferase 8
Zebrafish(100003790) K(lysine) acetyltransferase 8
cow(100125883) K(lysine) acetyltransferase 8
domestic cat(101089164) K(lysine) acetyltransferase 8
dog(479777) K(lysine) acetyltransferase 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032188 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032188 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032188 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026370 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026370 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026370 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032188 Rosetta Predictions human pricing
NM_182958 Rosetta Predictions human pricing
NM_001017378 Rosetta Predictions rat pricing
NM_026370 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359467 predicted 208
2 SASI_Hs01_00011170 predicted 453
3 SASI_Hs01_00011171 predicted 405
4 SASI_Hs01_00011172 predicted 521
5 SASI_Hs02_00359468 predicted 265
6 SASI_Hs01_00011174 predicted 233
7 SASI_Hs02_00359469 predicted 352
8 SASI_Hs02_00359470 predicted 271
9 SASI_Hs02_00359471 predicted 417
10 SASI_Hs02_00359472 predicted 458
11 SASI_Hs01_00011166 predicted 728
12 SASI_Hs01_00011167 predicted 583
13 SASI_Hs01_00011168 predicted 779
14 SASI_Hs01_00011169 predicted 746
15 SASI_Hs01_00011173 predicted 532
16 SASI_Hs01_00011175 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371093 predicted 206
2 SASI_Hs02_00371094 predicted 457
3 SASI_Hs02_00371095 predicted 407
4 SASI_Hs02_00371096 predicted 529
5 SASI_Hs02_00371097 predicted 264
6 SASI_Hs02_00371098 predicted 232
7 SASI_Hs02_00371099 predicted 345
8 SASI_Hs02_00371100 predicted 267
9 SASI_Hs02_00371101 predicted 421
10 SASI_Hs02_00371102 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017378 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070123 predicted 755
2 SASI_Rn01_00070124 predicted 1016
3 SASI_Rn01_00070125 predicted 728
4 SASI_Rn01_00070126 predicted 441
5 SASI_Rn01_00070127 predicted 1011
6 SASI_Rn01_00070128 predicted 1251
7 SASI_Rn01_00070129 predicted 564
8 SASI_Rn01_00070130 predicted 411
9 SASI_Rn01_00070131 predicted 732
10 SASI_Rn01_00070132 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090499 predicted 1025
2 SASI_Mm01_00090500 predicted 1259
3 SASI_Mm01_00090501 predicted 412
4 SASI_Mm01_00090502 predicted 560
5 SASI_Mm02_00330099 predicted 1143
6 SASI_Mm02_00330100 predicted 722
7 SASI_Mm01_00090505 predicted 771
8 SASI_Mm01_00090506 predicted 1016
9 SASI_Mm01_00090507 predicted 736
10 SASI_Mm01_00090508 predicted 1151
11 SASI_Mm01_00090503 predicted 453
12 SASI_Mm01_00090504 predicted 951
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032188
VALIDATED
KAT8 MISSION shRNA Bacterial Glycerol Stock
K(lysine) acetyltransferase 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032188.2-773s21c1
Sequence:CCGGATGGCAAAGACCATAAGATTTCTCGAGAAATCTTATGGTCTTTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032188.2-1211s21c1
Sequence:CCGGGTACCCTGCAATCCCTCAATACTCGAGTATTGAGGGATTGCAGGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032188.2-288s21c1
Sequence:CCGGTGTACACTACGTGGGCTTTAACTCGAGTTAAAGCCCACGTAGTGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_032188.1-781s1c1
Sequence:CCGGCCATAAGATTTACTGTCAGAACTCGAGTTCTGACAGTAAATCTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_032188.1-423s1c1
Sequence:CCGGGCAAGATCACTCGCAACCAAACTCGAGTTTGGTTGCGAGTGATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032188.1-472s1c1
Sequence:CCGGGCAGAAGACTTATGCAGAGATCTCGAGATCTCTGCATAAGTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_032188.1-577s1c1
Sequence:CCGGCGAAATTGATGCCTGGTATTTCTCGAGAAATACCAGGCATCAATTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032188.1-1303s1c1
Sequence:CCGGCCAGTATAAGAAACCACCCATCTCGAGATGGGTGGTTTCTTATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032188.2-566s21c1
Sequence:CCGGACATCGGGAACTACGAAATTGCTCGAGCAATTTCGTAGTTCCCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032188
VALIDATED
KAT8 MISSION shRNA shRNA Plasmid DNA
K(lysine) acetyltransferase 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032188.2-773s21c1
Sequence:CCGGATGGCAAAGACCATAAGATTTCTCGAGAAATCTTATGGTCTTTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032188.2-1211s21c1
Sequence:CCGGGTACCCTGCAATCCCTCAATACTCGAGTATTGAGGGATTGCAGGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032188.2-288s21c1
Sequence:CCGGTGTACACTACGTGGGCTTTAACTCGAGTTAAAGCCCACGTAGTGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_032188.1-781s1c1
Sequence:CCGGCCATAAGATTTACTGTCAGAACTCGAGTTCTGACAGTAAATCTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_032188.1-423s1c1
Sequence:CCGGGCAAGATCACTCGCAACCAAACTCGAGTTTGGTTGCGAGTGATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032188.1-472s1c1
Sequence:CCGGGCAGAAGACTTATGCAGAGATCTCGAGATCTCTGCATAAGTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_032188.1-577s1c1
Sequence:CCGGCGAAATTGATGCCTGGTATTTCTCGAGAAATACCAGGCATCAATTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032188.1-1303s1c1
Sequence:CCGGCCAGTATAAGAAACCACCCATCTCGAGATGGGTGGTTTCTTATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032188.2-566s21c1
Sequence:CCGGACATCGGGAACTACGAAATTGCTCGAGCAATTTCGTAGTTCCCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032188
VALIDATED
KAT8 MISSION shRNA Lentiviral Transduction Particles
K(lysine) acetyltransferase 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032188.2-773s21c1
Sequence:CCGGATGGCAAAGACCATAAGATTTCTCGAGAAATCTTATGGTCTTTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032188.2-1211s21c1
Sequence:CCGGGTACCCTGCAATCCCTCAATACTCGAGTATTGAGGGATTGCAGGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032188.2-288s21c1
Sequence:CCGGTGTACACTACGTGGGCTTTAACTCGAGTTAAAGCCCACGTAGTGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_032188.1-781s1c1
Sequence:CCGGCCATAAGATTTACTGTCAGAACTCGAGTTCTGACAGTAAATCTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_032188.1-423s1c1
Sequence:CCGGGCAAGATCACTCGCAACCAAACTCGAGTTTGGTTGCGAGTGATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032188.1-472s1c1
Sequence:CCGGGCAGAAGACTTATGCAGAGATCTCGAGATCTCTGCATAAGTCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_032188.1-577s1c1
Sequence:CCGGCGAAATTGATGCCTGGTATTTCTCGAGAAATACCAGGCATCAATTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032188.1-1303s1c1
Sequence:CCGGCCAGTATAAGAAACCACCCATCTCGAGATGGGTGGTTTCTTATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032188.2-566s21c1
Sequence:CCGGACATCGGGAACTACGAAATTGCTCGAGCAATTTCGTAGTTCCCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026370
VALIDATED
KAT8 MISSION shRNA Bacterial Glycerol Stock
K(lysine) acetyltransferase 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026370.1-901s1c1
Sequence:CCGGGCTCACATTGTTGGCTACTTTCTCGAGAAAGTAGCCAACAATGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026370.1-1016s1c1
Sequence:CCGGCCTTCAGTTATGAGCTCTCTACTCGAGTAGAGAGCTCATAACTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026370.1-369s1c1
Sequence:CCGGCGTGCAGAAGAACTCTGAGAACTCGAGTTCTCAGAGTTCTTCTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026370.1-444s1c1
Sequence:CCGGGCGAAAGCATGATGAGATCAACTCGAGTTGATCTCATCATGCTTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026370.1-422s1c1
Sequence:CCGGGCAAGATCACTCGAAACCAAACTCGAGTTTGGTTTCGAGTGATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026370
VALIDATED
KAT8 MISSION shRNA shRNA Plasmid DNA
K(lysine) acetyltransferase 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026370.1-901s1c1
Sequence:CCGGGCTCACATTGTTGGCTACTTTCTCGAGAAAGTAGCCAACAATGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026370.1-1016s1c1
Sequence:CCGGCCTTCAGTTATGAGCTCTCTACTCGAGTAGAGAGCTCATAACTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026370.1-369s1c1
Sequence:CCGGCGTGCAGAAGAACTCTGAGAACTCGAGTTCTCAGAGTTCTTCTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026370.1-444s1c1
Sequence:CCGGGCGAAAGCATGATGAGATCAACTCGAGTTGATCTCATCATGCTTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026370.1-422s1c1
Sequence:CCGGGCAAGATCACTCGAAACCAAACTCGAGTTTGGTTTCGAGTGATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026370
VALIDATED
KAT8 MISSION shRNA Lentiviral Transduction Particles
K(lysine) acetyltransferase 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026370.1-901s1c1
Sequence:CCGGGCTCACATTGTTGGCTACTTTCTCGAGAAAGTAGCCAACAATGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026370.1-1016s1c1
Sequence:CCGGCCTTCAGTTATGAGCTCTCTACTCGAGTAGAGAGCTCATAACTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026370.1-369s1c1
Sequence:CCGGCGTGCAGAAGAACTCTGAGAACTCGAGTTCTCAGAGTTCTTCTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026370.1-444s1c1
Sequence:CCGGGCGAAAGCATGATGAGATCAACTCGAGTTGATCTCATCATGCTTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026370.1-422s1c1
Sequence:CCGGGCAAGATCACTCGAAACCAAACTCGAGTTTGGTTTCGAGTGATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)