EMAIL THIS PAGE TO A FRIEND

KATNA1

katanin p60 (ATPase containing) subunit A 1

72 Gene Product Result for
UniProtKB ID: O75449, E1P5A3, Q5TFA8, Q5TFA9, Q86VN2, Q9NU52
Gene ID:
Human(11104) Summary: Microtubules, polymers of alpha and beta tubulin subunits, form the mitotic spindle of a dividing cell and help to organize membranous organelles during interphase. Katanin is a heterodimer that consists of a 60 kDa ATPase (p60 subunit A 1) and an 80 kDa accessory protein (p80 subunit B 1). The p60 subunit acts to sever and disassemble microtubules, while the p80 subunit targets the enzyme to the centrosome. This gene encodes the p80 subunit. This protein is a member of the AAA family of ATPases. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Feb 2011]
Mouse(23924) katanin p60 (ATPase-containing) subunit A1
Rat(292464) katanin p60 (ATPase-containing) subunit A1
Zebrafish(553631) katanin p60 (ATPase-containing) subunit A 1
cow(506715) katanin p60 (ATPase containing) subunit A 1
Horse(100064649) katanin p60 (ATPase containing) subunit A 1
chicken(421626) katanin p60 (ATPase containing) subunit A 1
domestic cat(101099465) katanin p60 (ATPase containing) subunit A 1
dog(476240) katanin p60 (ATPase containing) subunit A 1
sheep(101122604) katanin p60 (ATPase containing) subunit A 1
Domestic Rabbit(100341477) katanin p60 (ATPase containing) subunit A 1
domestic guinea pig(100717079) katanin p60 (ATPase containing) subunit A 1
naked mole-rat(101726567) katanin p60 (ATPase containing) subunit A 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007044 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011835 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011835 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011835 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007044 Rosetta Predictions human pricing
NM_001004217 Rosetta Predictions rat pricing
XM_579132 Rosetta Predictions rat pricing
NM_011835 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188621 predicted 1282
2 SASI_Hs01_00188623 predicted 920
3 SASI_Hs01_00188624 predicted 896
4 SASI_Hs01_00188625 predicted 738
5 SASI_Hs01_00188626 predicted 1127
6 SASI_Hs01_00188628 predicted 458
7 SASI_Hs01_00188629 predicted 1204
8 SASI_Hs01_00188630 predicted 487
9 SASI_Hs02_00342831 predicted 407
10 SASI_Hs02_00342832 predicted 441
11 SASI_Hs01_00188622 predicted 235
12 SASI_Hs01_00188627 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198205 predicted 1240
2 SASI_Rn01_00090514 predicted 758
3 SASI_Rn01_00090515 predicted 1071
4 SASI_Rn01_00090516 predicted 1153
5 SASI_Rn01_00090517 predicted 620
6 SASI_Rn02_00198206 predicted 444
7 SASI_Rn01_00090518 predicted 849
8 SASI_Rn01_00090519 predicted 907
9 SASI_Rn01_00090521 predicted 871
10 SASI_Rn02_00198207 predicted 517
11 SASI_Rn01_00090513 predicted 199
12 SASI_Rn01_00090520 predicted 330
13 SASI_Rn01_00090522 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00169857 predicted 1242
2 SASI_Rn01_00169858 predicted 766
3 SASI_Rn01_00169859 predicted 1069
4 SASI_Rn01_00169860 predicted 1155
5 SASI_Rn01_00169861 predicted 621
6 SASI_Rn01_00169862 predicted 860
7 SASI_Rn01_00169863 predicted 906
8 SASI_Rn01_00169864 predicted 874
9 SASI_Rn01_00169865 predicted 519
10 SASI_Rn01_00169866 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321552 predicted 1114
2 SASI_Mm02_00321553 predicted 295
3 SASI_Mm02_00321554 predicted 866
4 SASI_Mm02_00321555 predicted 669
5 SASI_Mm02_00321556 predicted 967
6 SASI_Mm02_00321557 predicted 937
7 SASI_Mm02_00321558 predicted 726
8 SASI_Mm02_00321559 predicted 1171
9 SASI_Mm02_00321560 predicted 649
10 SASI_Mm02_00321561 predicted 1322
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007044
VALIDATED
KATNA1 MISSION shRNA Bacterial Glycerol Stock
katanin p60 (ATPase containing) subunit A 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_007044.2-1160s1c1
Sequence:CCGGGCCTTGAGAAACGAATCTATACTCGAGTATAGATTCGTTTCTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007044.2-739s1c1
Sequence:CCGGCCCGAATTCTTTAAGGGCATTCTCGAGAATGCCCTTAAAGAATTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007044.2-1130s1c1
Sequence:CCGGCCTGGGATATAGATGAGGCTTCTCGAGAAGCCTCATCTATATCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007044.2-738s1c1
Sequence:CCGGGCCCGAATTCTTTAAGGGCATCTCGAGATGCCCTTAAAGAATTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_007044.2-124s1c1
Sequence:CCGGGTCTATTATCAGGGAGTTCTTCTCGAGAAGAACTCCCTGATAATAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007044.2-591s21c1
Sequence:CCGGTGATAGTACCGGATATGATAACTCGAGTTATCATATCCGGTACTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007044.2-1107s21c1
Sequence:CCGGGGTTCTGGCAGCTACTAATTTCTCGAGAAATTAGTAGCTGCCAGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007044.2-944s21c1
Sequence:GTACCGGATTCTCCAGCCACCATATTTACTCGAGTAAATATGGTGGCTGGAGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007044.2-666s21c1
Sequence:CCGGATGGGATGATATCGCTGATTTCTCGAGAAATCAGCGATATCATCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007044.2-112s21c1
Sequence:CCGGGACTCTGCGATGGTCTATTATCTCGAGATAATAGACCATCGCAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007044
VALIDATED
KATNA1 MISSION shRNA shRNA Plasmid DNA
katanin p60 (ATPase containing) subunit A 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_007044.2-1160s1c1
Sequence:CCGGGCCTTGAGAAACGAATCTATACTCGAGTATAGATTCGTTTCTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007044.2-739s1c1
Sequence:CCGGCCCGAATTCTTTAAGGGCATTCTCGAGAATGCCCTTAAAGAATTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007044.2-1130s1c1
Sequence:CCGGCCTGGGATATAGATGAGGCTTCTCGAGAAGCCTCATCTATATCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007044.2-738s1c1
Sequence:CCGGGCCCGAATTCTTTAAGGGCATCTCGAGATGCCCTTAAAGAATTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_007044.2-124s1c1
Sequence:CCGGGTCTATTATCAGGGAGTTCTTCTCGAGAAGAACTCCCTGATAATAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007044.2-591s21c1
Sequence:CCGGTGATAGTACCGGATATGATAACTCGAGTTATCATATCCGGTACTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007044.2-1107s21c1
Sequence:CCGGGGTTCTGGCAGCTACTAATTTCTCGAGAAATTAGTAGCTGCCAGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007044.2-944s21c1
Sequence:GTACCGGATTCTCCAGCCACCATATTTACTCGAGTAAATATGGTGGCTGGAGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007044.2-666s21c1
Sequence:CCGGATGGGATGATATCGCTGATTTCTCGAGAAATCAGCGATATCATCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007044.2-112s21c1
Sequence:CCGGGACTCTGCGATGGTCTATTATCTCGAGATAATAGACCATCGCAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007044
VALIDATED
KATNA1 MISSION shRNA Lentiviral Transduction Particles
katanin p60 (ATPase containing) subunit A 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_007044.2-1160s1c1
Sequence:CCGGGCCTTGAGAAACGAATCTATACTCGAGTATAGATTCGTTTCTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007044.2-739s1c1
Sequence:CCGGCCCGAATTCTTTAAGGGCATTCTCGAGAATGCCCTTAAAGAATTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007044.2-1130s1c1
Sequence:CCGGCCTGGGATATAGATGAGGCTTCTCGAGAAGCCTCATCTATATCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007044.2-738s1c1
Sequence:CCGGGCCCGAATTCTTTAAGGGCATCTCGAGATGCCCTTAAAGAATTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_007044.2-124s1c1
Sequence:CCGGGTCTATTATCAGGGAGTTCTTCTCGAGAAGAACTCCCTGATAATAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007044.2-591s21c1
Sequence:CCGGTGATAGTACCGGATATGATAACTCGAGTTATCATATCCGGTACTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007044.2-1107s21c1
Sequence:CCGGGGTTCTGGCAGCTACTAATTTCTCGAGAAATTAGTAGCTGCCAGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007044.2-944s21c1
Sequence:GTACCGGATTCTCCAGCCACCATATTTACTCGAGTAAATATGGTGGCTGGAGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007044.2-666s21c1
Sequence:CCGGATGGGATGATATCGCTGATTTCTCGAGAAATCAGCGATATCATCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007044.2-112s21c1
Sequence:CCGGGACTCTGCGATGGTCTATTATCTCGAGATAATAGACCATCGCAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011835
VALIDATED
KATNA1 MISSION shRNA Bacterial Glycerol Stock
katanin p60 (ATPase containing) subunit A 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011835.1-339s1c1
Sequence:CCGGGCTTCAAACTAGACATCACTTCTCGAGAAGTGATGTCTAGTTTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011835.1-644s1c1
Sequence:CCGGCCAGAGGCAAATAAGTTTGATCTCGAGATCAAACTTATTTGCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011835.1-260s1c1
Sequence:CCGGCGTCAGAAATGGCAACAGGTTCTCGAGAACCTGTTGCCATTTCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011835.1-1558s1c1
Sequence:CCGGCGAGAAATGGATAGTTGAGTTCTCGAGAACTCAACTATCCATTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011835.1-734s1c1
Sequence:CCGGCGGTGGTATGATATTGCTGATCTCGAGATCAGCAATATCATACCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011835.1-1558s21c1
Sequence:CCGGCGAGAAATGGATAGTTGAGTTCTCGAGAACTCAACTATCCATTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011835.1-644s21c1
Sequence:CCGGCCAGAGGCAAATAAGTTTGATCTCGAGATCAAACTTATTTGCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011835.1-734s21c1
Sequence:CCGGCGGTGGTATGATATTGCTGATCTCGAGATCAGCAATATCATACCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011835.1-260s21c1
Sequence:CCGGCGTCAGAAATGGCAACAGGTTCTCGAGAACCTGTTGCCATTTCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011835
VALIDATED
KATNA1 MISSION shRNA shRNA Plasmid DNA
katanin p60 (ATPase containing) subunit A 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011835.1-339s1c1
Sequence:CCGGGCTTCAAACTAGACATCACTTCTCGAGAAGTGATGTCTAGTTTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011835.1-644s1c1
Sequence:CCGGCCAGAGGCAAATAAGTTTGATCTCGAGATCAAACTTATTTGCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011835.1-260s1c1
Sequence:CCGGCGTCAGAAATGGCAACAGGTTCTCGAGAACCTGTTGCCATTTCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011835.1-1558s1c1
Sequence:CCGGCGAGAAATGGATAGTTGAGTTCTCGAGAACTCAACTATCCATTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011835.1-734s1c1
Sequence:CCGGCGGTGGTATGATATTGCTGATCTCGAGATCAGCAATATCATACCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011835.1-1558s21c1
Sequence:CCGGCGAGAAATGGATAGTTGAGTTCTCGAGAACTCAACTATCCATTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011835.1-644s21c1
Sequence:CCGGCCAGAGGCAAATAAGTTTGATCTCGAGATCAAACTTATTTGCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011835.1-734s21c1
Sequence:CCGGCGGTGGTATGATATTGCTGATCTCGAGATCAGCAATATCATACCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011835.1-260s21c1
Sequence:CCGGCGTCAGAAATGGCAACAGGTTCTCGAGAACCTGTTGCCATTTCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011835
VALIDATED
KATNA1 MISSION shRNA Lentiviral Transduction Particles
katanin p60 (ATPase containing) subunit A 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011835.1-339s1c1
Sequence:CCGGGCTTCAAACTAGACATCACTTCTCGAGAAGTGATGTCTAGTTTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011835.1-644s1c1
Sequence:CCGGCCAGAGGCAAATAAGTTTGATCTCGAGATCAAACTTATTTGCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011835.1-260s1c1
Sequence:CCGGCGTCAGAAATGGCAACAGGTTCTCGAGAACCTGTTGCCATTTCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011835.1-1558s1c1
Sequence:CCGGCGAGAAATGGATAGTTGAGTTCTCGAGAACTCAACTATCCATTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011835.1-734s1c1
Sequence:CCGGCGGTGGTATGATATTGCTGATCTCGAGATCAGCAATATCATACCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011835.1-1558s21c1
Sequence:CCGGCGAGAAATGGATAGTTGAGTTCTCGAGAACTCAACTATCCATTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011835.1-644s21c1
Sequence:CCGGCCAGAGGCAAATAAGTTTGATCTCGAGATCAAACTTATTTGCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011835.1-734s21c1
Sequence:CCGGCGGTGGTATGATATTGCTGATCTCGAGATCAGCAATATCATACCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011835.1-260s21c1
Sequence:CCGGCGTCAGAAATGGCAACAGGTTCTCGAGAACCTGTTGCCATTTCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)