EMAIL THIS PAGE TO A FRIEND

KATNAL1

katanin p60 subunit A-like 1

163 Gene Product Result for
UniProtKB ID: Q9BW62, A8K5X4
Gene ID:
Mouse(231912) katanin p60 subunit A-like 1
Rat(288449) katanin p60 subunit A-like 1
domestic guinea pig(100722108) katanin p60 subunit A-like 1
naked mole-rat(101706398) katanin p60 subunit A-like 1
sheep(101112580) katanin p60 subunit A-like 1
Domestic Rabbit(100328900) katanin p60 subunit A-like 1
Zebrafish(492790) katanin p60 subunit A-like 1
cow(537739) katanin p60 subunit A-like 1
domestic cat(101089567) katanin p60 subunit A-like 1
chicken(418920) katanin p60 subunit A-like 1
dog(486020) katanin p60 subunit A-like 1
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032116 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153572 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153572 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153572 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052081 MISSION® esiRNA esiRNA human KATNAL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014380 Rosetta Predictions human pricing
NM_032116 Rosetta Predictions human pricing
NM_001006956 Rosetta Predictions rat pricing
NM_153572 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306533 predicted 1149
2 SASI_Hs01_00137844 predicted 1017
3 SASI_Hs01_00137845 predicted 954
4 SASI_Hs01_00137846 predicted 881
5 SASI_Hs01_00137848 predicted 911
6 SASI_Hs02_00306534 predicted 1339
7 SASI_Hs01_00137849 predicted 776
8 SASI_Hs01_00137850 predicted 670
9 SASI_Hs01_00137851 predicted 1271
10 SASI_Hs01_00137852 predicted 1383
11 SASI_Hs01_00137847 predicted 606
12 SASI_Hs01_00137853 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359313 predicted 1179
2 SASI_Hs01_00218249 predicted 1044
3 SASI_Hs01_00218250 predicted 980
4 SASI_Hs01_00218251 predicted 917
5 SASI_Hs01_00218253 predicted 946
6 SASI_Hs02_00359314 predicted 1361
7 SASI_Hs01_00218254 predicted 809
8 SASI_Hs01_00218255 predicted 700
9 SASI_Hs01_00218256 predicted 1300
10 SASI_Hs01_00218257 predicted 1415
11 SASI_Hs01_00218252 predicted 637
12 SASI_Hs01_00218258 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109820 predicted 926
2 SASI_Rn02_00198506 predicted 987
3 SASI_Rn01_00109821 predicted 352
4 SASI_Rn01_00109822 predicted 833
5 SASI_Rn01_00109824 predicted 711
6 SASI_Rn01_00109825 predicted 608
7 SASI_Rn01_00109826 predicted 281
8 SASI_Rn01_00109827 predicted 268
9 SASI_Rn02_00198507 predicted 680
10 SASI_Rn02_00198508 predicted 770
11 SASI_Rn01_00109823 predicted 493
12 SASI_Rn01_00109828 predicted 430
13 SASI_Rn01_00109829 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153572 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146133 predicted 963
2 SASI_Mm02_00343377 predicted 931
3 SASI_Mm01_00146134 predicted 882
4 SASI_Mm01_00146135 predicted 199
5 SASI_Mm01_00146136 predicted 1037
6 SASI_Mm01_00146137 predicted 312
7 SASI_Mm01_00146138 predicted 448
8 SASI_Mm01_00146139 predicted 759
9 SASI_Mm01_00146141 predicted 383
10 SASI_Mm02_00343378 predicted 1066
11 SASI_Mm01_00146140 predicted 219
12 SASI_Mm01_00146142 predicted 477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032116
VALIDATED
KATNAL1 MISSION shRNA Bacterial Glycerol Stock
katanin p60 subunit A-like 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032116.3-1766s21c1
Sequence:CCGGATAATTGATGGCGAGAGTTTGCTCGAGCAAACTCTCGCCATCAATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032116.3-1190s21c1
Sequence:CCGGGGTATTGGCTGCTACTAATTTCTCGAGAAATTAGTAGCAGCCAATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032116.3-1309s21c1
Sequence:CCGGACCTTCGTGAGGTCGAATTAGCTCGAGCTAATTCGACCTCACGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032116.3-538s21c1
Sequence:CCGGTAGGCCGAGCACATCCTATATCTCGAGATATAGGATGTGCTCGGCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370982    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032116.3-1818s21c1
Sequence:CCGGTCCACGTATTCCTGCATTAATCTCGAGATTAATGCAGGAATACGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032116.3-312s21c1
Sequence:CCGGGAGGAATATGAACAAGTTAAACTCGAGTTTAACTTGTTCATATTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032116.3-4658s1c1
Sequence:CCGGGCTCCTTTAATTCCTCTGAAACTCGAGTTTCAGAGGAATTAAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032116.3-730s1c1
Sequence:CCGGCCAGGAATCCTAGCATTCATTCTCGAGAATGAATGCTAGGATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032116.3-1357s1c1
Sequence:CCGGCCGAGAAGATTGAGGGCTATTCTCGAGAATAGCCCTCAATCTTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032116.3-1494s1c1
Sequence:CCGGCCTGTTACCAAAGGAGACTTTCTCGAGAAAGTCTCCTTTGGTAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032116.3-572s1c1
Sequence:CCGGGCCTTCTACAAGTAGGGACAACTCGAGTTGTCCCTACTTGTAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032116
VALIDATED
KATNAL1 MISSION shRNA shRNA Plasmid DNA
katanin p60 subunit A-like 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032116.3-1766s21c1
Sequence:CCGGATAATTGATGGCGAGAGTTTGCTCGAGCAAACTCTCGCCATCAATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032116.3-1190s21c1
Sequence:CCGGGGTATTGGCTGCTACTAATTTCTCGAGAAATTAGTAGCAGCCAATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032116.3-1309s21c1
Sequence:CCGGACCTTCGTGAGGTCGAATTAGCTCGAGCTAATTCGACCTCACGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032116.3-538s21c1
Sequence:CCGGTAGGCCGAGCACATCCTATATCTCGAGATATAGGATGTGCTCGGCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370982    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032116.3-1818s21c1
Sequence:CCGGTCCACGTATTCCTGCATTAATCTCGAGATTAATGCAGGAATACGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032116.3-312s21c1
Sequence:CCGGGAGGAATATGAACAAGTTAAACTCGAGTTTAACTTGTTCATATTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032116.3-4658s1c1
Sequence:CCGGGCTCCTTTAATTCCTCTGAAACTCGAGTTTCAGAGGAATTAAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032116.3-730s1c1
Sequence:CCGGCCAGGAATCCTAGCATTCATTCTCGAGAATGAATGCTAGGATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032116.3-1357s1c1
Sequence:CCGGCCGAGAAGATTGAGGGCTATTCTCGAGAATAGCCCTCAATCTTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032116.3-1494s1c1
Sequence:CCGGCCTGTTACCAAAGGAGACTTTCTCGAGAAAGTCTCCTTTGGTAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032116.3-572s1c1
Sequence:CCGGGCCTTCTACAAGTAGGGACAACTCGAGTTGTCCCTACTTGTAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032116
VALIDATED
KATNAL1 MISSION shRNA Lentiviral Transduction Particles
katanin p60 subunit A-like 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032116.3-1766s21c1
Sequence:CCGGATAATTGATGGCGAGAGTTTGCTCGAGCAAACTCTCGCCATCAATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032116.3-1190s21c1
Sequence:CCGGGGTATTGGCTGCTACTAATTTCTCGAGAAATTAGTAGCAGCCAATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032116.3-1309s21c1
Sequence:CCGGACCTTCGTGAGGTCGAATTAGCTCGAGCTAATTCGACCTCACGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032116.3-538s21c1
Sequence:CCGGTAGGCCGAGCACATCCTATATCTCGAGATATAGGATGTGCTCGGCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370982    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032116.3-1818s21c1
Sequence:CCGGTCCACGTATTCCTGCATTAATCTCGAGATTAATGCAGGAATACGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032116.3-312s21c1
Sequence:CCGGGAGGAATATGAACAAGTTAAACTCGAGTTTAACTTGTTCATATTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032116.3-4658s1c1
Sequence:CCGGGCTCCTTTAATTCCTCTGAAACTCGAGTTTCAGAGGAATTAAAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032116.3-730s1c1
Sequence:CCGGCCAGGAATCCTAGCATTCATTCTCGAGAATGAATGCTAGGATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032116.3-1357s1c1
Sequence:CCGGCCGAGAAGATTGAGGGCTATTCTCGAGAATAGCCCTCAATCTTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032116.3-1494s1c1
Sequence:CCGGCCTGTTACCAAAGGAGACTTTCTCGAGAAAGTCTCCTTTGGTAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032116.3-572s1c1
Sequence:CCGGGCCTTCTACAAGTAGGGACAACTCGAGTTGTCCCTACTTGTAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153572
KATNAL1 MISSION shRNA Bacterial Glycerol Stock
katanin p60 subunit A-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153572.1-291s1c1
Sequence:CCGGGCAGGAACTCTTGGAAGAATACTCGAGTATTCTTCCAAGAGTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153572.1-453s1c1
Sequence:CCGGCCCTCAAATCAGGCGTCCAAACTCGAGTTTGGACGCCTGATTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153572.1-333s1c1
Sequence:CCGGCAGCACTTTAGAAAGCTTTAACTCGAGTTAAAGCTTTCTAAAGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153572.1-1024s1c1
Sequence:CCGGACGATCTTCATCGACGAAATTCTCGAGAATTTCGTCGATGAAGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153572.1-1022s1c1
Sequence:CCGGCCACGATCTTCATCGACGAAACTCGAGTTTCGTCGATGAAGATCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153572
KATNAL1 MISSION shRNA shRNA Plasmid DNA
katanin p60 subunit A-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153572.1-291s1c1
Sequence:CCGGGCAGGAACTCTTGGAAGAATACTCGAGTATTCTTCCAAGAGTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153572.1-453s1c1
Sequence:CCGGCCCTCAAATCAGGCGTCCAAACTCGAGTTTGGACGCCTGATTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153572.1-333s1c1
Sequence:CCGGCAGCACTTTAGAAAGCTTTAACTCGAGTTAAAGCTTTCTAAAGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153572.1-1024s1c1
Sequence:CCGGACGATCTTCATCGACGAAATTCTCGAGAATTTCGTCGATGAAGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153572.1-1022s1c1
Sequence:CCGGCCACGATCTTCATCGACGAAACTCGAGTTTCGTCGATGAAGATCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153572
KATNAL1 MISSION shRNA Lentiviral Transduction Particles
katanin p60 subunit A-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153572.1-291s1c1
Sequence:CCGGGCAGGAACTCTTGGAAGAATACTCGAGTATTCTTCCAAGAGTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153572.1-453s1c1
Sequence:CCGGCCCTCAAATCAGGCGTCCAAACTCGAGTTTGGACGCCTGATTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153572.1-333s1c1
Sequence:CCGGCAGCACTTTAGAAAGCTTTAACTCGAGTTAAAGCTTTCTAAAGTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153572.1-1024s1c1
Sequence:CCGGACGATCTTCATCGACGAAATTCTCGAGAATTTCGTCGATGAAGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153572.1-1022s1c1
Sequence:CCGGCCACGATCTTCATCGACGAAACTCGAGTTTCGTCGATGAAGATCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)