EMAIL THIS PAGE TO A FRIEND

KATNB1

katanin p80 (WD repeat containing) subunit B 1

55 Gene Product Result for
Synonyms: KAT
UniProtKB ID: Q9BVA0, A6NCG6, O60620
Gene ID:
Human(10300) Summary: Microtubules, polymers of alpha and beta tubulin subunits, form the mitotic spindle of a dividing cell and help to organize membranous organelles during interphase. Katanin is a heterodimer that consists of a 60 kDa ATPase (p60 subunit A 1) and an 80 kDa accessory protein (p80 subunit B 1). The p60 subunit acts to sever and disassemble microtubules, while the p80 subunit targets the enzyme to the centrosome. Katanin is a member of the AAA family of ATPases. [provided by RefSeq, Jul 2008]
Mouse(74187) katanin p80 (WD40-containing) subunit B 1
Rat(291852) katanin p80 (WD repeat containing) subunit B 1
domestic guinea pig(100721434) katanin p80 (WD repeat containing) subunit B 1
naked mole-rat(101720378) katanin p80 (WD repeat containing) subunit B 1
sheep(101103087) katanin p80 (WD repeat containing) subunit B 1
Domestic Rabbit(100346961) katanin p80 (WD repeat containing) subunit B 1
Zebrafish(406291) katanin p80 (WD repeat containing) subunit B 1
cow(508813) katanin p80 (WD repeat containing) subunit B 1
domestic cat(101086522) katanin p80 (WD repeat containing) subunit B 1
dog(612852) katanin p80 (WD repeat containing) subunit B 1
chicken(415631) katanin p80 (WD repeat containing) subunit B 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005886 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028805 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028805 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028805 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005886 Rosetta Predictions human pricing
NM_001024746 Rosetta Predictions rat pricing
NM_028805 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020032 predicted 873
2 SASI_Hs01_00020033 predicted 781
3 SASI_Hs01_00020034 predicted 499
4 SASI_Hs01_00020035 predicted 764
5 SASI_Hs01_00020038 predicted 560
6 SASI_Hs02_00340484 predicted 1523
7 SASI_Hs01_00020039 predicted 1252
8 SASI_Hs01_00020041 predicted 1774
9 SASI_Hs02_00340485 predicted 1763
10 SASI_Hs02_00340486 predicted 2240
11 SASI_Hs01_00020036 predicted 721
12 SASI_Hs01_00020037 predicted 2008
13 SASI_Hs01_00020040 predicted 2231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024746 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049234 predicted 489
2 SASI_Rn01_00049235 predicted 1373
3 SASI_Rn01_00049236 predicted 342
4 SASI_Rn01_00049237 predicted 782
5 SASI_Rn01_00049240 predicted 508
6 SASI_Rn02_00202619 predicted 861
7 SASI_Rn01_00049241 predicted 1383
8 SASI_Rn01_00049242 predicted 1579
9 SASI_Rn02_00202620 predicted 588
10 SASI_Rn02_00202621 predicted 1015
11 SASI_Rn01_00049238 predicted 876
12 SASI_Rn01_00049239 predicted 890
13 SASI_Rn01_00049243 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147772 predicted 1752
2 SASI_Mm01_00147773 predicted 1594
3 SASI_Mm02_00334419 predicted 755
4 SASI_Mm01_00147774 predicted 1736
5 SASI_Mm01_00147775 predicted 511
6 SASI_Mm01_00147776 predicted 1149
7 SASI_Mm01_00147777 predicted 1227
8 SASI_Mm01_00147778 predicted 1237
9 SASI_Mm01_00147779 predicted 1984
10 SASI_Mm01_00147781 predicted 1304
11 SASI_Mm01_00147780 predicted 1411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005886
KATNB1 MISSION shRNA Bacterial Glycerol Stock
katanin p80 (WD repeat containing) subunit B 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005886.2-1169s21c1
Sequence:CCGGTGATGTGGTCCTCGTCAACTGCTCGAGCAGTTGACGAGGACCACATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005886.2-1989s21c1
Sequence:CCGGGACCTCCTGAACATCGTCAACCTCGAGGTTGACGATGTTCAGGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005886.2-506s21c1
Sequence:CCGGCGTCAACCTGTGGTCCATCAACTCGAGTTGATGGACCACAGGTTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005886.1-574s1c1
Sequence:CCGGCGGCAAGATGATGTCTGAGTTCTCGAGAACTCAGACATCATCTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005886.1-1174s1c1
Sequence:CCGGCGCCGAGGACTACAACGAGATCTCGAGATCTCGTTGTAGTCCTCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005886.1-390s1c1
Sequence:CCGGGCGAGTTTGTAGCCTCTGGTTCTCGAGAACCAGAGGCTACAAACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005886.1-1891s1c1
Sequence:CCGGGCTCTGCTACAAGCAGCTTAACTCGAGTTAAGCTGCTTGTAGCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005886.1-2169s1c1
Sequence:CCGGAGCCCTGAACTCTTGAGACAACTCGAGTTGTCTCAAGAGTTCAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005886
KATNB1 MISSION shRNA shRNA Plasmid DNA
katanin p80 (WD repeat containing) subunit B 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005886.2-1169s21c1
Sequence:CCGGTGATGTGGTCCTCGTCAACTGCTCGAGCAGTTGACGAGGACCACATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005886.2-1989s21c1
Sequence:CCGGGACCTCCTGAACATCGTCAACCTCGAGGTTGACGATGTTCAGGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005886.2-506s21c1
Sequence:CCGGCGTCAACCTGTGGTCCATCAACTCGAGTTGATGGACCACAGGTTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005886.1-574s1c1
Sequence:CCGGCGGCAAGATGATGTCTGAGTTCTCGAGAACTCAGACATCATCTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005886.1-1174s1c1
Sequence:CCGGCGCCGAGGACTACAACGAGATCTCGAGATCTCGTTGTAGTCCTCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005886.1-390s1c1
Sequence:CCGGGCGAGTTTGTAGCCTCTGGTTCTCGAGAACCAGAGGCTACAAACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005886.1-1891s1c1
Sequence:CCGGGCTCTGCTACAAGCAGCTTAACTCGAGTTAAGCTGCTTGTAGCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005886.1-2169s1c1
Sequence:CCGGAGCCCTGAACTCTTGAGACAACTCGAGTTGTCTCAAGAGTTCAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005886
KATNB1 MISSION shRNA Lentiviral Transduction Particles
katanin p80 (WD repeat containing) subunit B 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005886.2-1169s21c1
Sequence:CCGGTGATGTGGTCCTCGTCAACTGCTCGAGCAGTTGACGAGGACCACATCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005886.2-1989s21c1
Sequence:CCGGGACCTCCTGAACATCGTCAACCTCGAGGTTGACGATGTTCAGGAGGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005886.2-506s21c1
Sequence:CCGGCGTCAACCTGTGGTCCATCAACTCGAGTTGATGGACCACAGGTTGACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005886.1-574s1c1
Sequence:CCGGCGGCAAGATGATGTCTGAGTTCTCGAGAACTCAGACATCATCTTGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005886.1-1174s1c1
Sequence:CCGGCGCCGAGGACTACAACGAGATCTCGAGATCTCGTTGTAGTCCTCGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005886.1-390s1c1
Sequence:CCGGGCGAGTTTGTAGCCTCTGGTTCTCGAGAACCAGAGGCTACAAACTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005886.1-1891s1c1
Sequence:CCGGGCTCTGCTACAAGCAGCTTAACTCGAGTTAAGCTGCTTGTAGCAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005886.1-2169s1c1
Sequence:CCGGAGCCCTGAACTCTTGAGACAACTCGAGTTGTCTCAAGAGTTCAGGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028805
VALIDATED
KATNB1 MISSION shRNA Bacterial Glycerol Stock
katanin p80 (WD repeat containing) subunit B 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028805.2-771s21c1
Sequence:CCGGAGGCTGTGTCTTCCGATATAGCTCGAGCTATATCGGAAGACACAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028805.2-1823s21c1
Sequence:CCGGAGGATGCCATGTCGCAGATACCTCGAGGTATCTGCGACATGGCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028805.2-492s21c1
Sequence:CCGGAGTCAACCTGTGGTCCATAAACTCGAGTTTATGGACCACAGGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028805.2-1393s21c1
Sequence:CCGGAGCAAGCCTCAGAGGGTAAAGCTCGAGCTTTACCCTCTGAGGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028805.2-2567s21c1
Sequence:CCGGTGTAAATTATCAGGCAGATTTCTCGAGAAATCTGCCTGATAATTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028805.1-1407s1c1
Sequence:CCGGGCGGAGGACTACAATGAGATTCTCGAGAATCTCATTGTAGTCCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028805.1-2477s1c1
Sequence:CCGGGCTGTAAATTATCAGGCAGATCTCGAGATCTGCCTGATAATTTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028805.1-868s1c1
Sequence:CCGGCCAATGAATATCTCCTAGCTTCTCGAGAAGCTAGGAGATATTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028805.1-1145s1c1
Sequence:CCGGCCAGAGTAATGTCTCCTCTTACTCGAGTAAGAGGAGACATTACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028805.1-1982s1c1
Sequence:CCGGGCAGAGCAAGTATGAGAGCTACTCGAGTAGCTCTCATACTTGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028805
VALIDATED
KATNB1 MISSION shRNA shRNA Plasmid DNA
katanin p80 (WD repeat containing) subunit B 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028805.2-771s21c1
Sequence:CCGGAGGCTGTGTCTTCCGATATAGCTCGAGCTATATCGGAAGACACAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028805.2-1823s21c1
Sequence:CCGGAGGATGCCATGTCGCAGATACCTCGAGGTATCTGCGACATGGCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028805.2-492s21c1
Sequence:CCGGAGTCAACCTGTGGTCCATAAACTCGAGTTTATGGACCACAGGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028805.2-1393s21c1
Sequence:CCGGAGCAAGCCTCAGAGGGTAAAGCTCGAGCTTTACCCTCTGAGGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028805.2-2567s21c1
Sequence:CCGGTGTAAATTATCAGGCAGATTTCTCGAGAAATCTGCCTGATAATTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028805.1-1407s1c1
Sequence:CCGGGCGGAGGACTACAATGAGATTCTCGAGAATCTCATTGTAGTCCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028805.1-2477s1c1
Sequence:CCGGGCTGTAAATTATCAGGCAGATCTCGAGATCTGCCTGATAATTTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028805.1-868s1c1
Sequence:CCGGCCAATGAATATCTCCTAGCTTCTCGAGAAGCTAGGAGATATTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028805.1-1145s1c1
Sequence:CCGGCCAGAGTAATGTCTCCTCTTACTCGAGTAAGAGGAGACATTACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028805.1-1982s1c1
Sequence:CCGGGCAGAGCAAGTATGAGAGCTACTCGAGTAGCTCTCATACTTGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028805
VALIDATED
KATNB1 MISSION shRNA Lentiviral Transduction Particles
katanin p80 (WD repeat containing) subunit B 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028805.2-771s21c1
Sequence:CCGGAGGCTGTGTCTTCCGATATAGCTCGAGCTATATCGGAAGACACAGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028805.2-1823s21c1
Sequence:CCGGAGGATGCCATGTCGCAGATACCTCGAGGTATCTGCGACATGGCATCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028805.2-492s21c1
Sequence:CCGGAGTCAACCTGTGGTCCATAAACTCGAGTTTATGGACCACAGGTTGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028805.2-1393s21c1
Sequence:CCGGAGCAAGCCTCAGAGGGTAAAGCTCGAGCTTTACCCTCTGAGGCTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028805.2-2567s21c1
Sequence:CCGGTGTAAATTATCAGGCAGATTTCTCGAGAAATCTGCCTGATAATTTACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028805.1-1407s1c1
Sequence:CCGGGCGGAGGACTACAATGAGATTCTCGAGAATCTCATTGTAGTCCTCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028805.1-2477s1c1
Sequence:CCGGGCTGTAAATTATCAGGCAGATCTCGAGATCTGCCTGATAATTTACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028805.1-868s1c1
Sequence:CCGGCCAATGAATATCTCCTAGCTTCTCGAGAAGCTAGGAGATATTCATTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028805.1-1145s1c1
Sequence:CCGGCCAGAGTAATGTCTCCTCTTACTCGAGTAAGAGGAGACATTACTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028805.1-1982s1c1
Sequence:CCGGGCAGAGCAAGTATGAGAGCTACTCGAGTAGCTCTCATACTTGCTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)