EMAIL THIS PAGE TO A FRIEND

KATNBL1

katanin p80 subunit B-like 1

154 Gene Product Result for
Synonyms: C15orf29
UniProtKB ID: Q9H079, A8KAF6, Q2TAC0, Q9H670
Gene ID:
Mouse(72425) katanin p80 subunit B like 1
Rat(691543) katanin p80 subunit B-like 1
Zebrafish(325430) katanin p80 subunit B-like 1
dog(607369) katanin p80 subunit B-like 1
cow(540295) katanin p80 subunit B-like 1
domestic cat(101097734) katanin p80 subunit B-like 1
sheep(101123043) katanin p80 subunit B-like 1
domestic guinea pig(100729475) katanin p80 subunit B-like 1
naked mole-rat(101718516) katanin p80 subunit B-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024713 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024713 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024713 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024254 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024254 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024254 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024713 Rosetta Predictions human pricing
NM_001109645 Rosetta Predictions rat pricing
NM_024254 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049734 predicted 479
2 SASI_Hs01_00049735 predicted 301
3 SASI_Hs01_00049736 predicted 680
4 SASI_Hs01_00049737 predicted 784
5 SASI_Hs01_00049738 predicted 684
6 SASI_Hs02_00357171 predicted 598
7 SASI_Hs01_00049739 predicted 778
8 SASI_Hs01_00049740 predicted 276
9 SASI_Hs01_00049741 predicted 266
10 SASI_Hs01_00049742 predicted 423
11 SASI_Hs01_00049743 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109645 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250382 predicted 970
2 SASI_Rn02_00250383 predicted 468
3 SASI_Rn02_00250384 predicted 791
4 SASI_Rn02_00250385 predicted 848
5 SASI_Rn02_00250386 predicted 802
6 SASI_Rn02_00250387 predicted 1046
7 SASI_Rn02_00250388 predicted 643
8 SASI_Rn02_00250389 predicted 843
9 SASI_Rn02_00250390 predicted 613
10 SASI_Rn02_00250391 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024254 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327642 predicted 1004
2 SASI_Mm01_00087420 predicted 514
3 SASI_Mm01_00087422 predicted 1047
4 SASI_Mm01_00087423 predicted 846
5 SASI_Mm01_00087424 predicted 660
6 SASI_Mm01_00087425 predicted 218
7 SASI_Mm01_00087426 predicted 703
8 SASI_Mm01_00087427 predicted 1062
9 SASI_Mm01_00087428 predicted 830
10 SASI_Mm01_00087429 predicted 765
11 SASI_Mm01_00087421 predicted 724
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024713
VALIDATED
KATNBL1 MISSION shRNA Bacterial Glycerol Stock
katanin p80 subunit B-like 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024713.2-1512s21c1
Sequence:CCGGCTTAAATGTGTGCAGCTATTTCTCGAGAAATAGCTGCACACATTTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024713.2-503s21c1
Sequence:CCGGCACCATGATAGTCGAACATATCTCGAGATATGTTCGACTATCATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024713.1-630s1c1
Sequence:CCGGGCTTATTTGTTGAGGATAGAACTCGAGTTCTATCCTCAACAAATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024713.2-1016s21c1
Sequence:CCGGCCAGGATATACTGGTAATATACTCGAGTATATTACCAGTATATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024713.1-282s1c1
Sequence:CCGGCGTAAAGTGATCTATCGCAGACTCGAGTCTGCGATAGATCACTTTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024713.1-1566s1c1
Sequence:CCGGCCAATGTGTTATGATACCAATCTCGAGATTGGTATCATAACACATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024713.1-431s1c1
Sequence:CCGGCCATGATAGTCGAACATATTTCTCGAGAAATATGTTCGACTATCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024713.1-138s1c1
Sequence:CCGGGAGGATCATTTCATTGATCTTCTCGAGAAGATCAATGAAATGATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024713.2-823s21c1
Sequence:CCGGTCTAGTAAAGTCACTACTTAACTCGAGTTAAGTAGTGACTTTACTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024713.1-939s1c1
Sequence:CCGGGTTCCAGGATATACTGGTAATCTCGAGATTACCAGTATATCCTGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024713.1-688s1c1
Sequence:CCGGCCAATTGTTTACAGGAAGAAACTCGAGTTTCTTCCTGTAAACAATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024713.1-537s1c1
Sequence:CCGGCATGAAACAATGGCCCAAGTTCTCGAGAACTTGGGCCATTGTTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024713.1-536s1c1
Sequence:CCGGCCATGAAACAATGGCCCAAGTCTCGAGACTTGGGCCATTGTTTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024713.2-704s21c1
Sequence:CCGGGCTTATTTGTTGAGGATAGAACTCGAGTTCTATCCTCAACAAATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024713
VALIDATED
KATNBL1 MISSION shRNA shRNA Plasmid DNA
katanin p80 subunit B-like 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024713.2-1512s21c1
Sequence:CCGGCTTAAATGTGTGCAGCTATTTCTCGAGAAATAGCTGCACACATTTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024713.2-503s21c1
Sequence:CCGGCACCATGATAGTCGAACATATCTCGAGATATGTTCGACTATCATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024713.1-630s1c1
Sequence:CCGGGCTTATTTGTTGAGGATAGAACTCGAGTTCTATCCTCAACAAATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024713.2-1016s21c1
Sequence:CCGGCCAGGATATACTGGTAATATACTCGAGTATATTACCAGTATATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024713.1-282s1c1
Sequence:CCGGCGTAAAGTGATCTATCGCAGACTCGAGTCTGCGATAGATCACTTTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024713.1-1566s1c1
Sequence:CCGGCCAATGTGTTATGATACCAATCTCGAGATTGGTATCATAACACATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024713.1-431s1c1
Sequence:CCGGCCATGATAGTCGAACATATTTCTCGAGAAATATGTTCGACTATCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024713.1-138s1c1
Sequence:CCGGGAGGATCATTTCATTGATCTTCTCGAGAAGATCAATGAAATGATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024713.2-823s21c1
Sequence:CCGGTCTAGTAAAGTCACTACTTAACTCGAGTTAAGTAGTGACTTTACTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024713.1-939s1c1
Sequence:CCGGGTTCCAGGATATACTGGTAATCTCGAGATTACCAGTATATCCTGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024713.1-688s1c1
Sequence:CCGGCCAATTGTTTACAGGAAGAAACTCGAGTTTCTTCCTGTAAACAATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024713.1-537s1c1
Sequence:CCGGCATGAAACAATGGCCCAAGTTCTCGAGAACTTGGGCCATTGTTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024713.1-536s1c1
Sequence:CCGGCCATGAAACAATGGCCCAAGTCTCGAGACTTGGGCCATTGTTTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024713.2-704s21c1
Sequence:CCGGGCTTATTTGTTGAGGATAGAACTCGAGTTCTATCCTCAACAAATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024713
VALIDATED
KATNBL1 MISSION shRNA Lentiviral Transduction Particles
katanin p80 subunit B-like 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024713.2-1512s21c1
Sequence:CCGGCTTAAATGTGTGCAGCTATTTCTCGAGAAATAGCTGCACACATTTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024713.2-503s21c1
Sequence:CCGGCACCATGATAGTCGAACATATCTCGAGATATGTTCGACTATCATGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024713.1-630s1c1
Sequence:CCGGGCTTATTTGTTGAGGATAGAACTCGAGTTCTATCCTCAACAAATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024713.2-1016s21c1
Sequence:CCGGCCAGGATATACTGGTAATATACTCGAGTATATTACCAGTATATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024713.1-282s1c1
Sequence:CCGGCGTAAAGTGATCTATCGCAGACTCGAGTCTGCGATAGATCACTTTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024713.1-1566s1c1
Sequence:CCGGCCAATGTGTTATGATACCAATCTCGAGATTGGTATCATAACACATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024713.1-431s1c1
Sequence:CCGGCCATGATAGTCGAACATATTTCTCGAGAAATATGTTCGACTATCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024713.1-138s1c1
Sequence:CCGGGAGGATCATTTCATTGATCTTCTCGAGAAGATCAATGAAATGATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024713.2-823s21c1
Sequence:CCGGTCTAGTAAAGTCACTACTTAACTCGAGTTAAGTAGTGACTTTACTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024713.1-939s1c1
Sequence:CCGGGTTCCAGGATATACTGGTAATCTCGAGATTACCAGTATATCCTGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024713.1-688s1c1
Sequence:CCGGCCAATTGTTTACAGGAAGAAACTCGAGTTTCTTCCTGTAAACAATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024713.1-537s1c1
Sequence:CCGGCATGAAACAATGGCCCAAGTTCTCGAGAACTTGGGCCATTGTTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024713.1-536s1c1
Sequence:CCGGCCATGAAACAATGGCCCAAGTCTCGAGACTTGGGCCATTGTTTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024713.2-704s21c1
Sequence:CCGGGCTTATTTGTTGAGGATAGAACTCGAGTTCTATCCTCAACAAATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024254
VALIDATED
KATNBL1 MISSION shRNA Bacterial Glycerol Stock
katanin p80 subunit B-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024254.3-1002s21c1
Sequence:CCGGCCAGGATATACTGGTAATATACTCGAGTATATTACCAGTATATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024254.2-611s1c1
Sequence:CCGGCCAGGTTCTATTCAGCAGGAACTCGAGTTCCTGCTGAATAGAACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024254.3-1871s21c1
Sequence:CCGGGTCCATGGAGTTGGCTAATTTCTCGAGAAATTAGCCAACTCCATGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024254.3-678s21c1
Sequence:CCGGAGTGAACTTGTAGCTTATTTACTCGAGTAAATAAGCTACAAGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024254.3-1025s21c1
Sequence:CCGGTAAGGATGTAGATGCTTATTTCTCGAGAAATAAGCATCTACATCCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024254.2-499s1c1
Sequence:CCGGGTCGGACATTTGTCATTAATACTCGAGTATTAATGACAAATGTCCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024254.2-1494s1c1
Sequence:CCGGGCTAATTTCTTCTGTTGGAAACTCGAGTTTCCAACAGAAGAAATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024254.3-192s1c1
Sequence:CCGGCGGAACTTCTCTAATAGTATTCTCGAGAATACTATTAGAGAAGTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024254.3-498s21c1
Sequence:CCGGAGTCGGACATTTGTCATTAATCTCGAGATTAATGACAAATGTCCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024254
VALIDATED
KATNBL1 MISSION shRNA shRNA Plasmid DNA
katanin p80 subunit B-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024254.3-1002s21c1
Sequence:CCGGCCAGGATATACTGGTAATATACTCGAGTATATTACCAGTATATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024254.2-611s1c1
Sequence:CCGGCCAGGTTCTATTCAGCAGGAACTCGAGTTCCTGCTGAATAGAACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024254.3-1871s21c1
Sequence:CCGGGTCCATGGAGTTGGCTAATTTCTCGAGAAATTAGCCAACTCCATGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024254.3-678s21c1
Sequence:CCGGAGTGAACTTGTAGCTTATTTACTCGAGTAAATAAGCTACAAGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024254.3-1025s21c1
Sequence:CCGGTAAGGATGTAGATGCTTATTTCTCGAGAAATAAGCATCTACATCCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024254.2-499s1c1
Sequence:CCGGGTCGGACATTTGTCATTAATACTCGAGTATTAATGACAAATGTCCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024254.2-1494s1c1
Sequence:CCGGGCTAATTTCTTCTGTTGGAAACTCGAGTTTCCAACAGAAGAAATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024254.3-192s1c1
Sequence:CCGGCGGAACTTCTCTAATAGTATTCTCGAGAATACTATTAGAGAAGTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024254.3-498s21c1
Sequence:CCGGAGTCGGACATTTGTCATTAATCTCGAGATTAATGACAAATGTCCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024254
VALIDATED
KATNBL1 MISSION shRNA Lentiviral Transduction Particles
katanin p80 subunit B-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024254.3-1002s21c1
Sequence:CCGGCCAGGATATACTGGTAATATACTCGAGTATATTACCAGTATATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024254.2-611s1c1
Sequence:CCGGCCAGGTTCTATTCAGCAGGAACTCGAGTTCCTGCTGAATAGAACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024254.3-1871s21c1
Sequence:CCGGGTCCATGGAGTTGGCTAATTTCTCGAGAAATTAGCCAACTCCATGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024254.3-678s21c1
Sequence:CCGGAGTGAACTTGTAGCTTATTTACTCGAGTAAATAAGCTACAAGTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024254.3-1025s21c1
Sequence:CCGGTAAGGATGTAGATGCTTATTTCTCGAGAAATAAGCATCTACATCCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024254.2-499s1c1
Sequence:CCGGGTCGGACATTTGTCATTAATACTCGAGTATTAATGACAAATGTCCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024254.2-1494s1c1
Sequence:CCGGGCTAATTTCTTCTGTTGGAAACTCGAGTTTCCAACAGAAGAAATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024254.3-192s1c1
Sequence:CCGGCGGAACTTCTCTAATAGTATTCTCGAGAATACTATTAGAGAAGTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024254.3-498s21c1
Sequence:CCGGAGTCGGACATTTGTCATTAATCTCGAGATTAATGACAAATGTCCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)