EMAIL THIS PAGE TO A FRIEND

KAZALD1

Kazal-type serine peptidase inhibitor domain 1

99 Gene Product Result for
Synonyms: BONO1 FKSG28 FKSG40 IGFBP-rP10
UniProtKB ID: Q96I82, D3DR74, Q6ZMB1, Q9BQ73
Gene ID:
Human(81621) Summary: This gene encodes a secreted member of the insulin growth factor-binding protein (IGFBP) superfamily. It contains an N-terminal insulin growth factor-binding domain, a central Kazal-type serine protease inhibitor and follistatin-like domain, and a C-terminal immunoglobulin-like domain. Studies of the mouse ortholog suggest that this gene product may have a function in bone development and bone regeneration. [provided by RefSeq, Feb 2009]
Mouse(107250) Kazal-type serine peptidase inhibitor domain 1
Rat(293997) Kazal-type serine peptidase inhibitor domain 1
chicken(423856) Kazal-type serine peptidase inhibitor domain 1
domestic cat(101095134) Kazal-type serine peptidase inhibitor domain 1
cow(617445) Kazal-type serine peptidase inhibitor domain 1
dog(609313) Kazal-type serine peptidase inhibitor domain 1
domestic guinea pig(100731220) Kazal-type serine peptidase inhibitor domain 1
naked mole-rat(101715439) Kazal-type serine peptidase inhibitor domain 1
sheep(101112689) Kazal-type serine peptidase inhibitor domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178929 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178929 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178929 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030929 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030929 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030929 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU076011 MISSION® esiRNA esiRNA targeting mouse Kazald1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030929 Rosetta Predictions human pricing
NM_001033064 Rosetta Predictions rat pricing
NM_178929 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239772 predicted 896
2 SASI_Hs01_00239773 predicted 861
3 SASI_Hs01_00239774 predicted 1176
4 SASI_Hs01_00239775 predicted 1274
5 SASI_Hs01_00239776 predicted 1211
6 SASI_Hs01_00239777 predicted 1561
7 SASI_Hs01_00239779 predicted 942
8 SASI_Hs01_00239780 predicted 840
9 SASI_Hs01_00239781 predicted 602
10 SASI_Hs02_00358490 predicted 880
11 SASI_Hs01_00239778 predicted 1390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033064 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039517 predicted 647
2 SASI_Rn02_00203623 predicted 766
3 SASI_Rn01_00039518 predicted 815
4 SASI_Rn01_00039519 predicted 1221
5 SASI_Rn01_00039520 predicted 1377
6 SASI_Rn01_00039521 predicted 772
7 SASI_Rn01_00039522 predicted 650
8 SASI_Rn01_00039523 predicted 1380
9 SASI_Rn01_00039524 predicted 1136
10 SASI_Rn01_00039525 predicted 1309
11 SASI_Rn01_00039526 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098233 predicted 1023
2 SASI_Mm01_00098234 predicted 663
3 SASI_Mm02_00349562 predicted 1095
4 SASI_Mm01_00098235 predicted 1066
5 SASI_Mm01_00098236 predicted 956
6 SASI_Mm01_00098237 predicted 845
7 SASI_Mm01_00098238 predicted 1044
8 SASI_Mm01_00098240 predicted 558
9 SASI_Mm01_00098241 predicted 793
10 SASI_Mm02_00349563 predicted 673
11 SASI_Mm01_00098239 predicted 1108
12 SASI_Mm01_00098242 predicted 904
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178929
KAZALD1 MISSION shRNA Bacterial Glycerol Stock
Kazal-type serine peptidase inhibitor domain 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178929.4-661s21c1
Sequence:CCGGTGTCGCAGCCTCACAATATTTCTCGAGAAATATTGTGAGGCTGCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178929.4-1032s21c1
Sequence:CCGGAGTGAAGAGTTGGGCGATTACCTCGAGGTAATCGCCCAACTCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178929.4-691s21c1
Sequence:CCGGCCGGACAGGATGTGATCTTTGCTCGAGCAAAGATCACATCCTGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178929.4-1153s21c1
Sequence:CCGGGGTCCTTACATGGATTGTTTACTCGAGTAAACAATCCATGTAAGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178929.4-173s21c1
Sequence:CCGGGTCCTTGCTACTACCATTATTCTCGAGAATAATGGTAGTAGCAAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178929.2-1186s1c1
Sequence:CCGGCCTCAGCTCATCTTTCCTCAACTCGAGTTGAGGAAAGATGAGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178929.2-664s1c1
Sequence:CCGGGCAGCCTCACAATATTTGGAACTCGAGTTCCAAATATTGTGAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178929.2-169s1c1
Sequence:CCGGGCTGTCCTTGCTACTACCATTCTCGAGAATGGTAGTAGCAAGGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178929.2-667s1c1
Sequence:CCGGGCCTCACAATATTTGGAATGTCTCGAGACATTCCAAATATTGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178929.2-985s1c1
Sequence:CCGGGCTGCAATCACGGAGTTTGTTCTCGAGAACAAACTCCGTGATTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178929
KAZALD1 MISSION shRNA shRNA Plasmid DNA
Kazal-type serine peptidase inhibitor domain 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178929.4-661s21c1
Sequence:CCGGTGTCGCAGCCTCACAATATTTCTCGAGAAATATTGTGAGGCTGCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178929.4-1032s21c1
Sequence:CCGGAGTGAAGAGTTGGGCGATTACCTCGAGGTAATCGCCCAACTCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178929.4-691s21c1
Sequence:CCGGCCGGACAGGATGTGATCTTTGCTCGAGCAAAGATCACATCCTGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178929.4-1153s21c1
Sequence:CCGGGGTCCTTACATGGATTGTTTACTCGAGTAAACAATCCATGTAAGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178929.4-173s21c1
Sequence:CCGGGTCCTTGCTACTACCATTATTCTCGAGAATAATGGTAGTAGCAAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178929.2-1186s1c1
Sequence:CCGGCCTCAGCTCATCTTTCCTCAACTCGAGTTGAGGAAAGATGAGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178929.2-664s1c1
Sequence:CCGGGCAGCCTCACAATATTTGGAACTCGAGTTCCAAATATTGTGAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178929.2-169s1c1
Sequence:CCGGGCTGTCCTTGCTACTACCATTCTCGAGAATGGTAGTAGCAAGGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178929.2-667s1c1
Sequence:CCGGGCCTCACAATATTTGGAATGTCTCGAGACATTCCAAATATTGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178929.2-985s1c1
Sequence:CCGGGCTGCAATCACGGAGTTTGTTCTCGAGAACAAACTCCGTGATTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178929
KAZALD1 MISSION shRNA Lentiviral Transduction Particles
Kazal-type serine peptidase inhibitor domain 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178929.4-661s21c1
Sequence:CCGGTGTCGCAGCCTCACAATATTTCTCGAGAAATATTGTGAGGCTGCGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178929.4-1032s21c1
Sequence:CCGGAGTGAAGAGTTGGGCGATTACCTCGAGGTAATCGCCCAACTCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178929.4-691s21c1
Sequence:CCGGCCGGACAGGATGTGATCTTTGCTCGAGCAAAGATCACATCCTGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178929.4-1153s21c1
Sequence:CCGGGGTCCTTACATGGATTGTTTACTCGAGTAAACAATCCATGTAAGGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178929.4-173s21c1
Sequence:CCGGGTCCTTGCTACTACCATTATTCTCGAGAATAATGGTAGTAGCAAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178929.2-1186s1c1
Sequence:CCGGCCTCAGCTCATCTTTCCTCAACTCGAGTTGAGGAAAGATGAGCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178929.2-664s1c1
Sequence:CCGGGCAGCCTCACAATATTTGGAACTCGAGTTCCAAATATTGTGAGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178929.2-169s1c1
Sequence:CCGGGCTGTCCTTGCTACTACCATTCTCGAGAATGGTAGTAGCAAGGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178929.2-667s1c1
Sequence:CCGGGCCTCACAATATTTGGAATGTCTCGAGACATTCCAAATATTGTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178929.2-985s1c1
Sequence:CCGGGCTGCAATCACGGAGTTTGTTCTCGAGAACAAACTCCGTGATTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030929
KAZALD1 MISSION shRNA Bacterial Glycerol Stock
Kazal-type serine peptidase inhibitor domain 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030929.3-1176s1c1
Sequence:CCGGCTGCGATCACTAAACCTGGTTCTCGAGAACCAGGTTTAGTGATCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030929.3-1212s1c1
Sequence:CCGGGAGAGTGAAGAGAATGACGATCTCGAGATCGTCATTCTCTTCACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030929.3-855s1c1
Sequence:CCGGCATCCATATGACACTTGGAATCTCGAGATTCCAAGTGTCATATGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030929.3-842s1c1
Sequence:CCGGCCAGATCGTGTCACATCCATACTCGAGTATGGATGTGACACGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030929.3-1327s1c1
Sequence:CCGGCCCTTCATCGACTGCTTTCATCTCGAGATGAAAGCAGTCGATGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030929
KAZALD1 MISSION shRNA shRNA Plasmid DNA
Kazal-type serine peptidase inhibitor domain 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030929.3-1176s1c1
Sequence:CCGGCTGCGATCACTAAACCTGGTTCTCGAGAACCAGGTTTAGTGATCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030929.3-1212s1c1
Sequence:CCGGGAGAGTGAAGAGAATGACGATCTCGAGATCGTCATTCTCTTCACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030929.3-855s1c1
Sequence:CCGGCATCCATATGACACTTGGAATCTCGAGATTCCAAGTGTCATATGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030929.3-842s1c1
Sequence:CCGGCCAGATCGTGTCACATCCATACTCGAGTATGGATGTGACACGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030929.3-1327s1c1
Sequence:CCGGCCCTTCATCGACTGCTTTCATCTCGAGATGAAAGCAGTCGATGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030929
KAZALD1 MISSION shRNA Lentiviral Transduction Particles
Kazal-type serine peptidase inhibitor domain 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030929.3-1176s1c1
Sequence:CCGGCTGCGATCACTAAACCTGGTTCTCGAGAACCAGGTTTAGTGATCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030929.3-1212s1c1
Sequence:CCGGGAGAGTGAAGAGAATGACGATCTCGAGATCGTCATTCTCTTCACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030929.3-855s1c1
Sequence:CCGGCATCCATATGACACTTGGAATCTCGAGATTCCAAGTGTCATATGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030929.3-842s1c1
Sequence:CCGGCCAGATCGTGTCACATCCATACTCGAGTATGGATGTGACACGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030929.3-1327s1c1
Sequence:CCGGCCCTTCATCGACTGCTTTCATCTCGAGATGAAAGCAGTCGATGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)