EMAIL THIS PAGE TO A FRIEND

KBTBD11

kelch repeat and BTB (POZ) domain containing 11

79 Gene Product Result for
Synonyms: KLHDC7C
UniProtKB ID: O94819, Q3L1I0
Gene ID:
Mouse(74901) kelch repeat and BTB (POZ) domain containing 11
Rat(306617) kelch repeat and BTB (POZ) domain containing 11
domestic guinea pig(101787268) kelch repeat and BTB (POZ) domain containing 11
naked mole-rat(101705392) kelch repeat and BTB (POZ) domain containing 11
chicken(428648) kelch repeat and BTB (POZ) domain containing 11
dog(491445) kelch repeat and BTB (POZ) domain containing 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA051159 Anti-KBTBD11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_486083 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_486083 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_486083 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014867 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014867 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014867 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014867 Rosetta Predictions human pricing
NM_001107326 Rosetta Predictions rat pricing
XM_486083 Rosetta Predictions mouse pricing
XM_921147 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136117 predicted 3300
2 SASI_Hs01_00136118 predicted 2447
3 SASI_Hs01_00136119 predicted 1722
4 SASI_Hs01_00136120 predicted 3300
5 SASI_Hs01_00136121 predicted 3215
6 SASI_Hs01_00136122 predicted 2675
7 SASI_Hs01_00136123 predicted 2787
8 SASI_Hs01_00136124 predicted 2441
9 SASI_Hs01_00136125 predicted 2537
10 SASI_Hs02_00346465 predicted 3249
11 SASI_Hs01_00136126 predicted 1566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227735 predicted 2092
2 SASI_Rn02_00227736 predicted 1964
3 SASI_Rn02_00227737 predicted 832
4 SASI_Rn02_00227738 predicted 1153
5 SASI_Rn02_00227739 predicted 2239
6 SASI_Rn02_00227740 predicted 2014
7 SASI_Rn02_00227741 predicted 1276
8 SASI_Rn02_00227742 predicted 914
9 SASI_Rn02_00227743 predicted 1882
10 SASI_Rn02_00227744 predicted 1336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486083 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426777 predicted 5073
2 SASI_Mm01_00285738 predicted 3863
3 SASI_Mm01_00285739 predicted 4706
4 SASI_Mm01_00285740 predicted 5122
5 SASI_Mm01_00285741 predicted 3959
6 SASI_Mm02_00426778 predicted 5315
7 SASI_Mm01_00285742 predicted 4243
8 SASI_Mm01_00285743 predicted 3213
9 SASI_Mm02_00426779 predicted 5448
10 SASI_Mm01_00285744 predicted 4461
11 SASI_Mm01_00285737 predicted 5088
12 SASI_Mm01_00285745 predicted 5439
13 SASI_Mm01_00285746 predicted 5391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_921147 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00442991 predicted 5039
2 SASI_Mm02_00442992 predicted 3827
3 SASI_Mm02_00442993 predicted 4672
4 SASI_Mm02_00442994 predicted 5088
5 SASI_Mm02_00442995 predicted 3925
6 SASI_Mm02_00442996 predicted 5278
7 SASI_Mm02_00442997 predicted 4205
8 SASI_Mm02_00442998 predicted 3170
9 SASI_Mm02_00442999 predicted 5406
10 SASI_Mm02_00443000 predicted 4417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_486083
KBTBD11 MISSION shRNA Bacterial Glycerol Stock
kelch repeat and BTB (POZ) domain containing 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486083.4-4458s21c1
Sequence:CCGGTGCCACCTGTAACGGAGAGATCTCGAGATCTCTCCGTTACAGGTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486083.4-4918s21c1
Sequence:CCGGGGCGTACTCTTTCCATTTGTACTCGAGTACAAATGGAAAGAGTACGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486083.4-3452s21c1
Sequence:CCGGTCGAGTCTTTGGACGAGCTTGCTCGAGCAAGCTCGTCCAAAGACTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_486083.4-7615s21c1
Sequence:CCGGATGCTCAGAGACCTATGTTAACTCGAGTTAACATAGGTCTCTGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486083.4-4598s21c1
Sequence:CCGGACGGCTTCCTCTATCGCTTTGCTCGAGCAAAGCGATAGAGGAAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_486083
KBTBD11 MISSION shRNA shRNA Plasmid DNA
kelch repeat and BTB (POZ) domain containing 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486083.4-4458s21c1
Sequence:CCGGTGCCACCTGTAACGGAGAGATCTCGAGATCTCTCCGTTACAGGTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486083.4-4918s21c1
Sequence:CCGGGGCGTACTCTTTCCATTTGTACTCGAGTACAAATGGAAAGAGTACGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486083.4-3452s21c1
Sequence:CCGGTCGAGTCTTTGGACGAGCTTGCTCGAGCAAGCTCGTCCAAAGACTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_486083.4-7615s21c1
Sequence:CCGGATGCTCAGAGACCTATGTTAACTCGAGTTAACATAGGTCTCTGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486083.4-4598s21c1
Sequence:CCGGACGGCTTCCTCTATCGCTTTGCTCGAGCAAAGCGATAGAGGAAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_486083
KBTBD11 MISSION shRNA Lentiviral Transduction Particles
kelch repeat and BTB (POZ) domain containing 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486083.4-4458s21c1
Sequence:CCGGTGCCACCTGTAACGGAGAGATCTCGAGATCTCTCCGTTACAGGTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486083.4-4918s21c1
Sequence:CCGGGGCGTACTCTTTCCATTTGTACTCGAGTACAAATGGAAAGAGTACGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486083.4-3452s21c1
Sequence:CCGGTCGAGTCTTTGGACGAGCTTGCTCGAGCAAGCTCGTCCAAAGACTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_486083.4-7615s21c1
Sequence:CCGGATGCTCAGAGACCTATGTTAACTCGAGTTAACATAGGTCTCTGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_486083.4-4598s21c1
Sequence:CCGGACGGCTTCCTCTATCGCTTTGCTCGAGCAAAGCGATAGAGGAAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014867
VALIDATED
KBTBD11 MISSION shRNA Bacterial Glycerol Stock
kelch repeat and BTB (POZ) domain containing 11
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000147901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014867.1-6510s1c1
Sequence:CCGGGCGATTCTCAAATGTTACCATCTCGAGATGGTAACATTTGAGAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183182    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014867.1-3946s1c1
Sequence:CCGGGCAAGTAAACTGCATGTATTTCTCGAGAAATACATGCAGTTTACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014867.1-4926s1c1
Sequence:CCGGGCGTTTCATTTAGTGAAGGAACTCGAGTTCCTTCACTAAATGAAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014867.1-3925s1c1
Sequence:CCGGCGTGCTTATCACCATAGATTTCTCGAGAAATCTATGGTGATAAGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014867
VALIDATED
KBTBD11 MISSION shRNA shRNA Plasmid DNA
kelch repeat and BTB (POZ) domain containing 11
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000147901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014867.1-6510s1c1
Sequence:CCGGGCGATTCTCAAATGTTACCATCTCGAGATGGTAACATTTGAGAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183182    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014867.1-3946s1c1
Sequence:CCGGGCAAGTAAACTGCATGTATTTCTCGAGAAATACATGCAGTTTACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014867.1-4926s1c1
Sequence:CCGGGCGTTTCATTTAGTGAAGGAACTCGAGTTCCTTCACTAAATGAAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014867.1-3925s1c1
Sequence:CCGGCGTGCTTATCACCATAGATTTCTCGAGAAATCTATGGTGATAAGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014867
VALIDATED
KBTBD11 MISSION shRNA Lentiviral Transduction Particles
kelch repeat and BTB (POZ) domain containing 11
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000147901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014867.1-6510s1c1
Sequence:CCGGGCGATTCTCAAATGTTACCATCTCGAGATGGTAACATTTGAGAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183182    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014867.1-3946s1c1
Sequence:CCGGGCAAGTAAACTGCATGTATTTCTCGAGAAATACATGCAGTTTACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014867.1-4926s1c1
Sequence:CCGGGCGTTTCATTTAGTGAAGGAACTCGAGTTCCTTCACTAAATGAAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014867.1-3925s1c1
Sequence:CCGGCGTGCTTATCACCATAGATTTCTCGAGAAATCTATGGTGATAAGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)