EMAIL THIS PAGE TO A FRIEND

KBTBD12

kelch repeat and BTB (POZ) domain containing 12

94 Gene Product Result for
Synonyms: KLHDC6
UniProtKB ID: Q3ZCT8, B5MCC6, Q6ZRK1
Gene ID:
Mouse(74589) kelch repeat and BTB (POZ) domain containing 12
Rat(502859) kelch repeat and BTB (POZ) domain containing 12
Zebrafish(559380) kelch repeat and BTB (POZ) domain containing 12
chicken(427587) kelch repeat and BTB (POZ) domain containing 12
dog(484625) kelch repeat and BTB (POZ) domain containing 12
Horse(100053890) kelch repeat and BTB (POZ) domain containing 12
cow(516527) kelch repeat and BTB (POZ) domain containing 12
domestic cat(101091854) kelch repeat and BTB (POZ) domain containing 12
domestic guinea pig(100720473) kelch repeat and BTB (POZ) domain containing 12
naked mole-rat(101709772) kelch repeat and BTB (POZ) domain containing 12
sheep(101107230) kelch repeat and BTB (POZ) domain containing 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029013 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029013 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029013 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207335 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207335 Rosetta Predictions human pricing
XM_001075598 Rosetta Predictions rat pricing
XM_578359 Rosetta Predictions rat pricing
NM_029013 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373881 predicted 725
2 SASI_Hs02_00373882 predicted 1299
3 SASI_Hs02_00373883 predicted 234
4 SASI_Hs02_00373884 predicted 818
5 SASI_Hs02_00373885 predicted 717
6 SASI_Hs02_00373886 predicted 216
7 SASI_Hs01_00091839 predicted 1760
8 SASI_Hs02_00373887 predicted 505
9 SASI_Hs02_00373888 predicted 196
10 SASI_Hs01_00091840 predicted 1425
11 SASI_Hs01_00091837 predicted 927
12 SASI_Hs01_00091838 predicted 646
13 SASI_Hs01_00091841 predicted 335
14 SASI_Hs01_00091842 predicted 1024
15 SASI_Hs01_00091843 predicted 612
16 SASI_Hs01_00091844 predicted 236
17 SASI_Hs01_00091845 predicted 727
18 SASI_Hs01_00091846 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075598 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350372 predicted 645
2 SASI_Rn02_00350373 predicted 585
3 SASI_Rn02_00350374 predicted 1472
4 SASI_Rn02_00350375 predicted 950
5 SASI_Rn02_00350376 predicted 396
6 SASI_Rn02_00350377 predicted 1336
7 SASI_Rn02_00350378 predicted 233
8 SASI_Rn02_00350379 predicted 506
9 SASI_Rn02_00350380 predicted 1164
10 SASI_Rn02_00350381 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174619 predicted 2762
2 SASI_Rn01_00174620 predicted 2053
3 SASI_Rn01_00174621 predicted 1677
4 SASI_Rn01_00174622 predicted 339
5 SASI_Rn01_00174623 predicted 995
6 SASI_Rn01_00174624 predicted 1115
7 SASI_Rn01_00174625 predicted 415
8 SASI_Rn01_00174626 predicted 2679
9 SASI_Rn01_00174627 predicted 1034
10 SASI_Rn01_00174628 predicted 1740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194178 predicted 1233
2 SASI_Mm01_00194179 predicted 401
3 SASI_Mm01_00194180 predicted 727
4 SASI_Mm02_00334754 predicted 362
5 SASI_Mm01_00194181 predicted 1005
6 SASI_Mm01_00194182 predicted 638
7 SASI_Mm01_00194183 predicted 740
8 SASI_Mm01_00194184 predicted 215
9 SASI_Mm01_00194185 predicted 664
10 SASI_Mm01_00194186 predicted 987
11 SASI_Mm01_00194187 predicted 1210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029013
KBTBD12 MISSION shRNA Bacterial Glycerol Stock
kelch repeat and BTB (POZ) domain containing 12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029013.2-603s21c1
Sequence:CCGGGATCAGTCGAAGAAGTATTTACTCGAGTAAATACTTCTTCGACTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029013.2-901s21c1
Sequence:CCGGTAATCCAGAATGCGTTCAAAGCTCGAGCTTTGAACGCATTCTGGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029013.2-812s21c1
Sequence:CCGGAGTCAGACTGGAACTTATAAACTCGAGTTTATAAGTTCCAGTCTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029013.2-744s21c1
Sequence:CCGGTTGGTTCTGAGATGGGTAAACCTCGAGGTTTACCCATCTCAGAACCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029013.1-1362s1c1
Sequence:CCGGCCTACTCAGCAGTCTATATTTCTCGAGAAATATAGACTGCTGAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029013.1-302s1c1
Sequence:CCGGCGCTGCCTTTAGTCCTTATTTCTCGAGAAATAAGGACTAAAGGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029013.1-192s1c1
Sequence:CCGGCATAGCTTGAACTTACTAGATCTCGAGATCTAGTAAGTTCAAGCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029013.1-249s1c1
Sequence:CCGGGATGTAGTGCTCATAGCAGAACTCGAGTTCTGCTATGAGCACTACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029013.1-690s1c1
Sequence:CCGGGCACTTATTAAGTCTGATGATCTCGAGATCATCAGACTTAATAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029013
KBTBD12 MISSION shRNA shRNA Plasmid DNA
kelch repeat and BTB (POZ) domain containing 12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029013.2-603s21c1
Sequence:CCGGGATCAGTCGAAGAAGTATTTACTCGAGTAAATACTTCTTCGACTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029013.2-901s21c1
Sequence:CCGGTAATCCAGAATGCGTTCAAAGCTCGAGCTTTGAACGCATTCTGGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029013.2-812s21c1
Sequence:CCGGAGTCAGACTGGAACTTATAAACTCGAGTTTATAAGTTCCAGTCTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029013.2-744s21c1
Sequence:CCGGTTGGTTCTGAGATGGGTAAACCTCGAGGTTTACCCATCTCAGAACCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029013.1-1362s1c1
Sequence:CCGGCCTACTCAGCAGTCTATATTTCTCGAGAAATATAGACTGCTGAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029013.1-302s1c1
Sequence:CCGGCGCTGCCTTTAGTCCTTATTTCTCGAGAAATAAGGACTAAAGGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029013.1-192s1c1
Sequence:CCGGCATAGCTTGAACTTACTAGATCTCGAGATCTAGTAAGTTCAAGCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029013.1-249s1c1
Sequence:CCGGGATGTAGTGCTCATAGCAGAACTCGAGTTCTGCTATGAGCACTACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029013.1-690s1c1
Sequence:CCGGGCACTTATTAAGTCTGATGATCTCGAGATCATCAGACTTAATAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029013
KBTBD12 MISSION shRNA Lentiviral Transduction Particles
kelch repeat and BTB (POZ) domain containing 12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029013.2-603s21c1
Sequence:CCGGGATCAGTCGAAGAAGTATTTACTCGAGTAAATACTTCTTCGACTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029013.2-901s21c1
Sequence:CCGGTAATCCAGAATGCGTTCAAAGCTCGAGCTTTGAACGCATTCTGGATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029013.2-812s21c1
Sequence:CCGGAGTCAGACTGGAACTTATAAACTCGAGTTTATAAGTTCCAGTCTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029013.2-744s21c1
Sequence:CCGGTTGGTTCTGAGATGGGTAAACCTCGAGGTTTACCCATCTCAGAACCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029013.1-1362s1c1
Sequence:CCGGCCTACTCAGCAGTCTATATTTCTCGAGAAATATAGACTGCTGAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029013.1-302s1c1
Sequence:CCGGCGCTGCCTTTAGTCCTTATTTCTCGAGAAATAAGGACTAAAGGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029013.1-192s1c1
Sequence:CCGGCATAGCTTGAACTTACTAGATCTCGAGATCTAGTAAGTTCAAGCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029013.1-249s1c1
Sequence:CCGGGATGTAGTGCTCATAGCAGAACTCGAGTTCTGCTATGAGCACTACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029013.1-690s1c1
Sequence:CCGGGCACTTATTAAGTCTGATGATCTCGAGATCATCAGACTTAATAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207335
KBTBD12 MISSION shRNA Bacterial Glycerol Stock
kelch repeat and BTB (POZ) domain containing 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207335.1-561s1c1
Sequence:CCGGCATGAGGTTATCTCCAAAGAACTCGAGTTCTTTGGAGATAACCTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207335.1-299s1c1
Sequence:CCGGGAAGTACTCTAAGTACCGATTCTCGAGAATCGGTACTTAGAGTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207335.1-702s1c1
Sequence:CCGGCCTTCAGATTTGGTGGAAGAACTCGAGTTCTTCCACCAAATCTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207335.1-327s1c1
Sequence:CCGGGCTGTAGTCAACAGTGAGATTCTCGAGAATCTCACTGTTGACTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207335.1-917s1c1
Sequence:CCGGCCAGCCTGATAGGGTAAATAACTCGAGTTATTTACCCTATCAGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207335
KBTBD12 MISSION shRNA shRNA Plasmid DNA
kelch repeat and BTB (POZ) domain containing 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207335.1-561s1c1
Sequence:CCGGCATGAGGTTATCTCCAAAGAACTCGAGTTCTTTGGAGATAACCTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207335.1-299s1c1
Sequence:CCGGGAAGTACTCTAAGTACCGATTCTCGAGAATCGGTACTTAGAGTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207335.1-702s1c1
Sequence:CCGGCCTTCAGATTTGGTGGAAGAACTCGAGTTCTTCCACCAAATCTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207335.1-327s1c1
Sequence:CCGGGCTGTAGTCAACAGTGAGATTCTCGAGAATCTCACTGTTGACTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207335.1-917s1c1
Sequence:CCGGCCAGCCTGATAGGGTAAATAACTCGAGTTATTTACCCTATCAGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207335
KBTBD12 MISSION shRNA Lentiviral Transduction Particles
kelch repeat and BTB (POZ) domain containing 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207335.1-561s1c1
Sequence:CCGGCATGAGGTTATCTCCAAAGAACTCGAGTTCTTTGGAGATAACCTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207335.1-299s1c1
Sequence:CCGGGAAGTACTCTAAGTACCGATTCTCGAGAATCGGTACTTAGAGTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207335.1-702s1c1
Sequence:CCGGCCTTCAGATTTGGTGGAAGAACTCGAGTTCTTCCACCAAATCTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207335.1-327s1c1
Sequence:CCGGGCTGTAGTCAACAGTGAGATTCTCGAGAATCTCACTGTTGACTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207335.1-917s1c1
Sequence:CCGGCCAGCCTGATAGGGTAAATAACTCGAGTTATTTACCCTATCAGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)