EMAIL THIS PAGE TO A FRIEND

KBTBD13

kelch repeat and BTB (POZ) domain containing 13

42 Gene Product Result for
Synonyms: HCG1645727 NEM6
UniProtKB ID: C9JR72
Gene ID:
Human(390594) Summary: The gene belongs to a family of genes encoding proteins containing a BTB domain and several kelch repeats. The BTB domain functions as a protein-protein interaction module, which includes an ability to self-associate or to interact with non-BTB domain-containing proteins. The kelch motif typically occurs in groups of five to seven repeats, and has been found in proteins with diverse functions. Known functions of these family members include transcription regulation, ion channel tetramerization and gating, protein ubiquitination or degradation, and cytoskeleton regulation. The exact function of this family member has yet to be determined. [provided by RefSeq, Jun 2010]
Mouse(74492) kelch repeat and BTB (POZ) domain containing 13
sheep(101110418) kelch repeat and BTB (POZ) domain containing 13
naked mole-rat(101725451) kelch repeat and BTB (POZ) domain containing 13
chicken(427511) kelch repeat and BTB (POZ) domain containing 13
dog(487601) kelch repeat and BTB (POZ) domain containing 13
cow(527160) kelch repeat and BTB (POZ) domain containing 13
domestic cat(101096734) kelch repeat and BTB (POZ) domain containing 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101362 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028974 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028974 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028974 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU067211 MISSION® esiRNA esiRNA targeting mouse 5430433E21Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101362 Rosetta Predictions human pricing
NM_028974 Rosetta Predictions mouse pricing
XM_134954 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322705 predicted 1144
2 SASI_Hs02_00322706 predicted 280
3 SASI_Hs02_00322707 predicted 1053
4 SASI_Hs02_00322708 predicted 900
5 SASI_Hs02_00322709 predicted 1088
6 SASI_Hs02_00322710 predicted 1012
7 SASI_Hs02_00322711 predicted 760
8 SASI_Hs02_00322712 predicted 285
9 SASI_Hs02_00322713 predicted 302
10 SASI_Hs02_00322714 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334693 predicted 1048
2 SASI_Mm02_00334694 predicted 1636
3 SASI_Mm02_00334695 predicted 1651
4 SASI_Mm02_00334696 predicted 1201
5 SASI_Mm02_00334697 predicted 1645
6 SASI_Mm02_00334698 predicted 1410
7 SASI_Mm02_00334699 predicted 1221
8 SASI_Mm02_00334700 predicted 1675
9 SASI_Mm02_00334701 predicted 1645
10 SASI_Mm02_00334702 predicted 1471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_134954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224750 predicted 1058
2 SASI_Mm01_00224751 predicted 1645
3 SASI_Mm01_00224752 predicted 1662
4 SASI_Mm01_00224753 predicted 1203
5 SASI_Mm01_00224754 predicted 1644
6 SASI_Mm01_00224755 predicted 1416
7 SASI_Mm01_00224756 predicted 1217
8 SASI_Mm01_00224757 predicted 1676
9 SASI_Mm01_00224758 predicted 1646
10 SASI_Mm01_00224759 predicted 1485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101362
KBTBD13 MISSION shRNA Bacterial Glycerol Stock
kelch repeat and BTB (POZ) domain containing 13
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101362.1-1071s21c1
Sequence:CCGGCAACGGACCTTCCGACGACTTCTCGAGAAGTCGTCGGAAGGTCCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101362.1-1207s21c1
Sequence:CCGGGTCTATACGGTCAACCGCATGCTCGAGCATGCGGTTGACCGTATAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101362.1-529s21c1
Sequence:CCGGCTGTGTTACCTGGACGAGGAACTCGAGTTCCTCGTCCAGGTAACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101362.1-615s21c1
Sequence:CCGGCACGCTGGGCAACAAGCTTTACTCGAGTAAAGCTTGTTGCCCAGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101362.1-296s21c1
Sequence:CCGGACAACCTCACGTCGGACAACTCTCGAGAGTTGTCCGACGTGAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101362
KBTBD13 MISSION shRNA shRNA Plasmid DNA
kelch repeat and BTB (POZ) domain containing 13
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101362.1-1071s21c1
Sequence:CCGGCAACGGACCTTCCGACGACTTCTCGAGAAGTCGTCGGAAGGTCCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101362.1-1207s21c1
Sequence:CCGGGTCTATACGGTCAACCGCATGCTCGAGCATGCGGTTGACCGTATAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101362.1-529s21c1
Sequence:CCGGCTGTGTTACCTGGACGAGGAACTCGAGTTCCTCGTCCAGGTAACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101362.1-615s21c1
Sequence:CCGGCACGCTGGGCAACAAGCTTTACTCGAGTAAAGCTTGTTGCCCAGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101362.1-296s21c1
Sequence:CCGGACAACCTCACGTCGGACAACTCTCGAGAGTTGTCCGACGTGAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101362
KBTBD13 MISSION shRNA Lentiviral Transduction Particles
kelch repeat and BTB (POZ) domain containing 13
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101362.1-1071s21c1
Sequence:CCGGCAACGGACCTTCCGACGACTTCTCGAGAAGTCGTCGGAAGGTCCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101362.1-1207s21c1
Sequence:CCGGGTCTATACGGTCAACCGCATGCTCGAGCATGCGGTTGACCGTATAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101362.1-529s21c1
Sequence:CCGGCTGTGTTACCTGGACGAGGAACTCGAGTTCCTCGTCCAGGTAACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101362.1-615s21c1
Sequence:CCGGCACGCTGGGCAACAAGCTTTACTCGAGTAAAGCTTGTTGCCCAGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101362.1-296s21c1
Sequence:CCGGACAACCTCACGTCGGACAACTCTCGAGAGTTGTCCGACGTGAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028974
KBTBD13 MISSION shRNA Bacterial Glycerol Stock
kelch repeat and BTB (POZ) domain containing 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028974.1-1223s21c1
Sequence:CCGGGTGTATCCACGTTGGTCTATGCTCGAGCATAGACCAACGTGGATACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028974.1-1139s21c1
Sequence:CCGGCATCGCTACCTGGCCAATTTGCTCGAGCAAATTGGCCAGGTAGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028974.1-732s21c1
Sequence:CCGGTCACCAACCGCGCTATGATATCTCGAGATATCATAGCGCGGTTGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028974.1-1054s21c1
Sequence:CCGGAGTCTCTATGTAGTACGAAATCTCGAGATTTCGTACTACATAGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028974.1-1655s21c1
Sequence:CCGGAGTCTAGCTATAGCTACTATACTCGAGTATAGTAGCTATAGCTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028974
KBTBD13 MISSION shRNA shRNA Plasmid DNA
kelch repeat and BTB (POZ) domain containing 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028974.1-1223s21c1
Sequence:CCGGGTGTATCCACGTTGGTCTATGCTCGAGCATAGACCAACGTGGATACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028974.1-1139s21c1
Sequence:CCGGCATCGCTACCTGGCCAATTTGCTCGAGCAAATTGGCCAGGTAGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028974.1-732s21c1
Sequence:CCGGTCACCAACCGCGCTATGATATCTCGAGATATCATAGCGCGGTTGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028974.1-1054s21c1
Sequence:CCGGAGTCTCTATGTAGTACGAAATCTCGAGATTTCGTACTACATAGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028974.1-1655s21c1
Sequence:CCGGAGTCTAGCTATAGCTACTATACTCGAGTATAGTAGCTATAGCTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028974
KBTBD13 MISSION shRNA Lentiviral Transduction Particles
kelch repeat and BTB (POZ) domain containing 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028974.1-1223s21c1
Sequence:CCGGGTGTATCCACGTTGGTCTATGCTCGAGCATAGACCAACGTGGATACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028974.1-1139s21c1
Sequence:CCGGCATCGCTACCTGGCCAATTTGCTCGAGCAAATTGGCCAGGTAGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028974.1-732s21c1
Sequence:CCGGTCACCAACCGCGCTATGATATCTCGAGATATCATAGCGCGGTTGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028974.1-1054s21c1
Sequence:CCGGAGTCTCTATGTAGTACGAAATCTCGAGATTTCGTACTACATAGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028974.1-1655s21c1
Sequence:CCGGAGTCTAGCTATAGCTACTATACTCGAGTATAGTAGCTATAGCTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)