EMAIL THIS PAGE TO A FRIEND

KBTBD2

kelch repeat and BTB (POZ) domain containing 2

119 Gene Product Result for
Synonyms: BKLHD1
UniProtKB ID: Q8IY47, A8K9T7, Q86Y62, Q9P239, Q9UFM7, Q9Y382
Gene ID:
Mouse(210973) kelch repeat and BTB (POZ) domain containing 2
Rat(312372) kelch repeat and BTB (POZ) domain containing 2
Zebrafish(563254) kelch repeat and BTB (POZ) domain containing 2
chicken(420749) kelch repeat and BTB (POZ) domain containing 2
dog(482391) kelch repeat and BTB (POZ) domain containing 2
domestic cat(101090757) kelch repeat and BTB (POZ) domain containing 2
cow(514920) kelch repeat and BTB (POZ) domain containing 2
Horse(100055296) kelch repeat and BTB (POZ) domain containing 2
domestic guinea pig(100721706) kelch repeat and BTB (POZ) domain containing 2
naked mole-rat(101719614) kelch repeat and BTB (POZ) domain containing 2
sheep(101120743) kelch repeat and BTB (POZ) domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA021133 Anti-KBTBD2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015483 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145958 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145958 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145958 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015483 Rosetta Predictions human pricing
NM_001107861 Rosetta Predictions rat pricing
NM_145958 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102590 predicted 1221
2 SASI_Hs01_00102591 predicted 588
3 SASI_Hs01_00102592 predicted 2181
4 SASI_Hs01_00102593 predicted 2129
5 SASI_Hs01_00102595 predicted 1335
6 SASI_Hs01_00102596 predicted 1372
7 SASI_Hs01_00102598 predicted 661
8 SASI_Hs02_00347935 predicted 678
9 SASI_Hs01_00102599 predicted 1697
10 SASI_Hs02_00347936 predicted 2343
11 SASI_Hs01_00102594 predicted 1698
12 SASI_Hs01_00102597 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233005 predicted 927
2 SASI_Rn02_00233006 predicted 2003
3 SASI_Rn02_00233007 predicted 778
4 SASI_Rn02_00233008 predicted 2282
5 SASI_Rn02_00233009 predicted 502
6 SASI_Rn02_00233010 predicted 1948
7 SASI_Rn02_00233011 predicted 956
8 SASI_Rn02_00233012 predicted 529
9 SASI_Rn02_00233013 predicted 561
10 SASI_Rn02_00233014 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145958 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341425 predicted 1322
2 SASI_Mm02_00341426 predicted 1355
3 SASI_Mm02_00341427 predicted 2212
4 SASI_Mm02_00341428 predicted 1561
5 SASI_Mm02_00341429 predicted 779
6 SASI_Mm02_00341430 predicted 684
7 SASI_Mm02_00341431 predicted 761
8 SASI_Mm02_00341432 predicted 1368
9 SASI_Mm02_00341433 predicted 2081
10 SASI_Mm02_00341434 predicted 2264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015483
VALIDATED
KBTBD2 MISSION shRNA Bacterial Glycerol Stock
kelch repeat and BTB (POZ) domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015483.1-2045s21c1
Sequence:CCGGGTCTTCAGTAACTGTGGAAATCTCGAGATTTCCACAGTTACTGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015483.1-1338s21c1
Sequence:CCGGCCAAGACTTGGGATGACTAAACTCGAGTTTAGTCATCCCAAGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015483.1-1268s21c1
Sequence:CCGGAGGTCTGCCACCCAATGATAACTCGAGTTATCATTGGGTGGCAGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_015483.1-2174s21c1
Sequence:CCGGTATGCGAGAAACCCACTTAAACTCGAGTTTAAGTGGGTTTCTCGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015483.1-2319s1c1
Sequence:CCGGCTCTATCCATCCTGCCTTGAACTCGAGTTCAAGGCAGGATGGATAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015483.1-690s1c1
Sequence:CCGGCCTTGTCATAAGATGGTTCTTCTCGAGAAGAACCATCTTATGACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015483.1-2713s1c1
Sequence:CCGGCCTGTGTATGTACAGTTCAAACTCGAGTTTGAACTGTACATACACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015483.1-2045s1c1
Sequence:CCGGGTCTTCAGTAACTGTGGAAATCTCGAGATTTCCACAGTTACTGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168558    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015483.1-3147s1c1
Sequence:CCGGGCGTGGAGCTTTAATCAGAAACTCGAGTTTCTGATTAAAGCTCCACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166877    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015483.1-2763s1c1
Sequence:CCGGCCTAGTGTGATGTATCACAAACTCGAGTTTGTGATACATCACACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015483
VALIDATED
KBTBD2 MISSION shRNA shRNA Plasmid DNA
kelch repeat and BTB (POZ) domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015483.1-2045s21c1
Sequence:CCGGGTCTTCAGTAACTGTGGAAATCTCGAGATTTCCACAGTTACTGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015483.1-1338s21c1
Sequence:CCGGCCAAGACTTGGGATGACTAAACTCGAGTTTAGTCATCCCAAGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015483.1-1268s21c1
Sequence:CCGGAGGTCTGCCACCCAATGATAACTCGAGTTATCATTGGGTGGCAGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_015483.1-2174s21c1
Sequence:CCGGTATGCGAGAAACCCACTTAAACTCGAGTTTAAGTGGGTTTCTCGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015483.1-2319s1c1
Sequence:CCGGCTCTATCCATCCTGCCTTGAACTCGAGTTCAAGGCAGGATGGATAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015483.1-690s1c1
Sequence:CCGGCCTTGTCATAAGATGGTTCTTCTCGAGAAGAACCATCTTATGACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015483.1-2713s1c1
Sequence:CCGGCCTGTGTATGTACAGTTCAAACTCGAGTTTGAACTGTACATACACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015483.1-2045s1c1
Sequence:CCGGGTCTTCAGTAACTGTGGAAATCTCGAGATTTCCACAGTTACTGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168558    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015483.1-3147s1c1
Sequence:CCGGGCGTGGAGCTTTAATCAGAAACTCGAGTTTCTGATTAAAGCTCCACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166877    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015483.1-2763s1c1
Sequence:CCGGCCTAGTGTGATGTATCACAAACTCGAGTTTGTGATACATCACACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015483
VALIDATED
KBTBD2 MISSION shRNA Lentiviral Transduction Particles
kelch repeat and BTB (POZ) domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015483.1-2045s21c1
Sequence:CCGGGTCTTCAGTAACTGTGGAAATCTCGAGATTTCCACAGTTACTGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015483.1-1338s21c1
Sequence:CCGGCCAAGACTTGGGATGACTAAACTCGAGTTTAGTCATCCCAAGTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015483.1-1268s21c1
Sequence:CCGGAGGTCTGCCACCCAATGATAACTCGAGTTATCATTGGGTGGCAGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_015483.1-2174s21c1
Sequence:CCGGTATGCGAGAAACCCACTTAAACTCGAGTTTAAGTGGGTTTCTCGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015483.1-2319s1c1
Sequence:CCGGCTCTATCCATCCTGCCTTGAACTCGAGTTCAAGGCAGGATGGATAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015483.1-690s1c1
Sequence:CCGGCCTTGTCATAAGATGGTTCTTCTCGAGAAGAACCATCTTATGACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015483.1-2713s1c1
Sequence:CCGGCCTGTGTATGTACAGTTCAAACTCGAGTTTGAACTGTACATACACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015483.1-2045s1c1
Sequence:CCGGGTCTTCAGTAACTGTGGAAATCTCGAGATTTCCACAGTTACTGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168558    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015483.1-3147s1c1
Sequence:CCGGGCGTGGAGCTTTAATCAGAAACTCGAGTTTCTGATTAAAGCTCCACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166877    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015483.1-2763s1c1
Sequence:CCGGCCTAGTGTGATGTATCACAAACTCGAGTTTGTGATACATCACACTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145958
VALIDATED
KBTBD2 MISSION shRNA Bacterial Glycerol Stock
kelch repeat and BTB (POZ) domain containing 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145958.2-3574s21c1
Sequence:CCGGGATTGTGTGTAGGTATCTAATCTCGAGATTAGATACCTACACACAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145958.2-881s21c1
Sequence:CCGGGCCGCCTTGCAGATGATAATACTCGAGTATTATCATCTGCAAGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145958.2-1768s21c1
Sequence:CCGGGGTTTGCTGTGAAGGCTATATCTCGAGATATAGCCTTCACAGCAAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145958.2-1572s21c1
Sequence:CCGGCAGTTGTAACTCCGGATAATGCTCGAGCATTATCCGGAGTTACAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145958.2-2254s21c1
Sequence:CCGGTATGCGAGAAACCCACTTAAACTCGAGTTTAAGTGGGTTTCTCGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145958.1-1326s1c1
Sequence:CCGGCCTGTCTTGAAGAATCTCCATCTCGAGATGGAGATTCTTCAAGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145958.1-108s1c1
Sequence:CCGGGCGACAACTTAAATGTAGAAACTCGAGTTTCTACATTTAAGTTGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145958
VALIDATED
KBTBD2 MISSION shRNA shRNA Plasmid DNA
kelch repeat and BTB (POZ) domain containing 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145958.2-3574s21c1
Sequence:CCGGGATTGTGTGTAGGTATCTAATCTCGAGATTAGATACCTACACACAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145958.2-881s21c1
Sequence:CCGGGCCGCCTTGCAGATGATAATACTCGAGTATTATCATCTGCAAGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145958.2-1768s21c1
Sequence:CCGGGGTTTGCTGTGAAGGCTATATCTCGAGATATAGCCTTCACAGCAAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145958.2-1572s21c1
Sequence:CCGGCAGTTGTAACTCCGGATAATGCTCGAGCATTATCCGGAGTTACAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145958.2-2254s21c1
Sequence:CCGGTATGCGAGAAACCCACTTAAACTCGAGTTTAAGTGGGTTTCTCGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145958.1-1326s1c1
Sequence:CCGGCCTGTCTTGAAGAATCTCCATCTCGAGATGGAGATTCTTCAAGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145958.1-108s1c1
Sequence:CCGGGCGACAACTTAAATGTAGAAACTCGAGTTTCTACATTTAAGTTGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145958
VALIDATED
KBTBD2 MISSION shRNA Lentiviral Transduction Particles
kelch repeat and BTB (POZ) domain containing 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145958.2-3574s21c1
Sequence:CCGGGATTGTGTGTAGGTATCTAATCTCGAGATTAGATACCTACACACAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145958.2-881s21c1
Sequence:CCGGGCCGCCTTGCAGATGATAATACTCGAGTATTATCATCTGCAAGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145958.2-1768s21c1
Sequence:CCGGGGTTTGCTGTGAAGGCTATATCTCGAGATATAGCCTTCACAGCAAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145958.2-1572s21c1
Sequence:CCGGCAGTTGTAACTCCGGATAATGCTCGAGCATTATCCGGAGTTACAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145958.2-2254s21c1
Sequence:CCGGTATGCGAGAAACCCACTTAAACTCGAGTTTAAGTGGGTTTCTCGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145958.1-1326s1c1
Sequence:CCGGCCTGTCTTGAAGAATCTCCATCTCGAGATGGAGATTCTTCAAGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145958.1-108s1c1
Sequence:CCGGGCGACAACTTAAATGTAGAAACTCGAGTTTCTACATTTAAGTTGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)