EMAIL THIS PAGE TO A FRIEND

KBTBD4

kelch repeat and BTB (POZ) domain containing 4

97 Gene Product Result for
Synonyms: BKLHD4 HSPC252
UniProtKB ID: Q9NVX7, D3DQS1, D3DQS2, Q6IA85, Q9BUC3, Q9NV76
Gene ID:
Mouse(67136) kelch repeat and BTB (POZ) domain containing 4
Rat(311185) kelch repeat and BTB (POZ) domain containing 4
Zebrafish(393178) kelch repeat and BTB (POZ) domain containing 4
cow(617482) kelch repeat and BTB (POZ) domain containing 4
domestic cat(101096668) kelch repeat and BTB (POZ) domain containing 4
dog(483621) kelch repeat and BTB (POZ) domain containing 4
chicken(423180) kelch repeat and BTB (POZ) domain containing 4
domestic guinea pig(100728212) kelch repeat and BTB (POZ) domain containing 4
naked mole-rat(101698370) kelch repeat and BTB (POZ) domain containing 4
sheep(101118557) kelch repeat and BTB (POZ) domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016506 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025991 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025991 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025991 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016506 Rosetta Predictions human pricing
NM_018095 Rosetta Predictions human pricing
NM_001107746 Rosetta Predictions rat pricing
NM_025991 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180991 predicted 2006
2 SASI_Hs01_00180992 predicted 2190
3 SASI_Hs01_00180993 predicted 2121
4 SASI_Hs01_00180994 predicted 1130
5 SASI_Hs01_00180995 predicted 1129
6 SASI_Hs01_00180996 predicted 415
7 SASI_Hs01_00180997 predicted 468
8 SASI_Hs01_00180998 predicted 2014
9 SASI_Hs01_00180999 predicted 2200
10 SASI_Hs02_00349577 predicted 2111
11 SASI_Hs01_00181000 predicted 2005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021180 predicted 1921
2 SASI_Hs01_00021181 predicted 2101
3 SASI_Hs01_00021182 predicted 2037
4 SASI_Hs01_00021183 predicted 1039
5 SASI_Hs01_00021184 predicted 1037
6 SASI_Hs01_00021185 predicted 325
7 SASI_Hs01_00021186 predicted 385
8 SASI_Hs01_00021187 predicted 1924
9 SASI_Hs01_00021188 predicted 2119
10 SASI_Hs02_00351278 predicted 2025
11 SASI_Hs01_00021189 predicted 1927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107746 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231865 predicted 705
2 SASI_Rn02_00231866 predicted 698
3 SASI_Rn02_00231867 predicted 796
4 SASI_Rn02_00231868 predicted 319
5 SASI_Rn02_00231869 predicted 1118
6 SASI_Rn02_00231870 predicted 979
7 SASI_Rn02_00231871 predicted 398
8 SASI_Rn02_00231872 predicted 514
9 SASI_Rn02_00231873 predicted 218
10 SASI_Rn02_00231874 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025991 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180584 predicted 766
2 SASI_Mm01_00180585 predicted 467
3 SASI_Mm01_00180586 predicted 1429
4 SASI_Mm01_00180587 predicted 1662
5 SASI_Mm01_00180588 predicted 1569
6 SASI_Mm01_00180590 predicted 1548
7 SASI_Mm02_00329445 predicted 1212
8 SASI_Mm02_00329446 predicted 771
9 SASI_Mm01_00180591 predicted 778
10 SASI_Mm01_00180592 predicted 289
11 SASI_Mm01_00180589 predicted 1308
12 SASI_Mm01_00180593 predicted 1052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016506
VALIDATED
KBTBD4 MISSION shRNA Bacterial Glycerol Stock
kelch repeat and BTB (POZ) domain containing 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016506.5-2138s21c1
Sequence:CCGGCCACAAAGAATTAGGTGTTAACTCGAGTTAACACCTAATTCTTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016506.5-1061s21c1
Sequence:CCGGGCATGTGGAAGTGCAACAATGCTCGAGCATTGTTGCACTTCCACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016506.5-1602s21c1
Sequence:CCGGTGTCTTCCGGGACCGATATAACTCGAGTTATATCGGTCCCGGAAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016506.5-2191s21c1
Sequence:CCGGGACTAAGCTGAAGGTGTACTTCTCGAGAAGTACACCTTCAGCTTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016506.3-1677s1c1
Sequence:CCGGGCTGCTTACCAATTTGCAGTTCTCGAGAACTGCAAATTGGTAAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016506.3-1191s1c1
Sequence:CCGGCGCAGTCATTTATTATCGCGTCTCGAGACGCGATAATAAATGACTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140781    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016506.3-1962s1c1
Sequence:CCGGGCTTGCTTAGAGCAAGCCTTTCTCGAGAAAGGCTTGCTCTAAGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016506.3-1664s1c1
Sequence:CCGGGAGGTATTAAGGTGCTGCTTACTCGAGTAAGCAGCACCTTAATACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016506.3-363s1c1
Sequence:CCGGCCGATCCATGTTCACTTCCAACTCGAGTTGGAAGTGAACATGGATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016506.3-444s1c1
Sequence:CCGGGCTCCTGGTTGATTATATCTACTCGAGTAGATATAATCAACCAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016506.3-212s1c1
Sequence:CCGGCTTTCAAAGATCGGTCACATTCTCGAGAATGTGACCGATCTTTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016506.3-781s1c1
Sequence:CCGGGAAGCCTGGATCAACTTTAATCTCGAGATTAAAGTTGATCCAGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016506
VALIDATED
KBTBD4 MISSION shRNA shRNA Plasmid DNA
kelch repeat and BTB (POZ) domain containing 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016506.5-2138s21c1
Sequence:CCGGCCACAAAGAATTAGGTGTTAACTCGAGTTAACACCTAATTCTTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016506.5-1061s21c1
Sequence:CCGGGCATGTGGAAGTGCAACAATGCTCGAGCATTGTTGCACTTCCACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016506.5-1602s21c1
Sequence:CCGGTGTCTTCCGGGACCGATATAACTCGAGTTATATCGGTCCCGGAAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016506.5-2191s21c1
Sequence:CCGGGACTAAGCTGAAGGTGTACTTCTCGAGAAGTACACCTTCAGCTTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016506.3-1677s1c1
Sequence:CCGGGCTGCTTACCAATTTGCAGTTCTCGAGAACTGCAAATTGGTAAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016506.3-1191s1c1
Sequence:CCGGCGCAGTCATTTATTATCGCGTCTCGAGACGCGATAATAAATGACTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140781    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016506.3-1962s1c1
Sequence:CCGGGCTTGCTTAGAGCAAGCCTTTCTCGAGAAAGGCTTGCTCTAAGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016506.3-1664s1c1
Sequence:CCGGGAGGTATTAAGGTGCTGCTTACTCGAGTAAGCAGCACCTTAATACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016506.3-363s1c1
Sequence:CCGGCCGATCCATGTTCACTTCCAACTCGAGTTGGAAGTGAACATGGATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016506.3-444s1c1
Sequence:CCGGGCTCCTGGTTGATTATATCTACTCGAGTAGATATAATCAACCAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016506.3-212s1c1
Sequence:CCGGCTTTCAAAGATCGGTCACATTCTCGAGAATGTGACCGATCTTTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016506.3-781s1c1
Sequence:CCGGGAAGCCTGGATCAACTTTAATCTCGAGATTAAAGTTGATCCAGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016506
VALIDATED
KBTBD4 MISSION shRNA Lentiviral Transduction Particles
kelch repeat and BTB (POZ) domain containing 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016506.5-2138s21c1
Sequence:CCGGCCACAAAGAATTAGGTGTTAACTCGAGTTAACACCTAATTCTTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016506.5-1061s21c1
Sequence:CCGGGCATGTGGAAGTGCAACAATGCTCGAGCATTGTTGCACTTCCACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016506.5-1602s21c1
Sequence:CCGGTGTCTTCCGGGACCGATATAACTCGAGTTATATCGGTCCCGGAAGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016506.5-2191s21c1
Sequence:CCGGGACTAAGCTGAAGGTGTACTTCTCGAGAAGTACACCTTCAGCTTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016506.3-1677s1c1
Sequence:CCGGGCTGCTTACCAATTTGCAGTTCTCGAGAACTGCAAATTGGTAAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016506.3-1191s1c1
Sequence:CCGGCGCAGTCATTTATTATCGCGTCTCGAGACGCGATAATAAATGACTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140781    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016506.3-1962s1c1
Sequence:CCGGGCTTGCTTAGAGCAAGCCTTTCTCGAGAAAGGCTTGCTCTAAGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016506.3-1664s1c1
Sequence:CCGGGAGGTATTAAGGTGCTGCTTACTCGAGTAAGCAGCACCTTAATACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016506.3-363s1c1
Sequence:CCGGCCGATCCATGTTCACTTCCAACTCGAGTTGGAAGTGAACATGGATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016506.3-444s1c1
Sequence:CCGGGCTCCTGGTTGATTATATCTACTCGAGTAGATATAATCAACCAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016506.3-212s1c1
Sequence:CCGGCTTTCAAAGATCGGTCACATTCTCGAGAATGTGACCGATCTTTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016506.3-781s1c1
Sequence:CCGGGAAGCCTGGATCAACTTTAATCTCGAGATTAAAGTTGATCCAGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025991
KBTBD4 MISSION shRNA Bacterial Glycerol Stock
kelch repeat and BTB (POZ) domain containing 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025991.3-1192s21c1
Sequence:CCGGGCAGTTATCTACTATCGGGTACTCGAGTACCCGATAGTAGATAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025991.3-363s21c1
Sequence:CCGGCCGATCCATGTTCACATCCAACTCGAGTTGGATGTGAACATGGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025991.3-1132s21c1
Sequence:CCGGCCTGGGAAAGATGCCATATATCTCGAGATATATGGCATCTTTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025991.3-1677s21c1
Sequence:CCGGGCTGCTTACCAACTTGCAGTTCTCGAGAACTGCAAGTTGGTAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025991.1-1678s1c1
Sequence:CCGGGCTGCTTACCAACTTGCAGTTCTCGAGAACTGCAAGTTGGTAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025991.1-2146s1c1
Sequence:CCGGCCAGCAAGAATCAACTGTAAACTCGAGTTTACAGTTGATTCTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025991.1-1193s1c1
Sequence:CCGGGCAGTTATCTACTATCGGGTACTCGAGTACCCGATAGTAGATAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025991.1-364s1c1
Sequence:CCGGCCGATCCATGTTCACATCCAACTCGAGTTGGATGTGAACATGGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025991.1-1133s1c1
Sequence:CCGGCCTGGGAAAGATGCCATATATCTCGAGATATATGGCATCTTTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025991
KBTBD4 MISSION shRNA shRNA Plasmid DNA
kelch repeat and BTB (POZ) domain containing 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025991.3-1192s21c1
Sequence:CCGGGCAGTTATCTACTATCGGGTACTCGAGTACCCGATAGTAGATAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025991.3-363s21c1
Sequence:CCGGCCGATCCATGTTCACATCCAACTCGAGTTGGATGTGAACATGGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025991.3-1132s21c1
Sequence:CCGGCCTGGGAAAGATGCCATATATCTCGAGATATATGGCATCTTTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025991.3-1677s21c1
Sequence:CCGGGCTGCTTACCAACTTGCAGTTCTCGAGAACTGCAAGTTGGTAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025991.1-1678s1c1
Sequence:CCGGGCTGCTTACCAACTTGCAGTTCTCGAGAACTGCAAGTTGGTAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025991.1-2146s1c1
Sequence:CCGGCCAGCAAGAATCAACTGTAAACTCGAGTTTACAGTTGATTCTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025991.1-1193s1c1
Sequence:CCGGGCAGTTATCTACTATCGGGTACTCGAGTACCCGATAGTAGATAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025991.1-364s1c1
Sequence:CCGGCCGATCCATGTTCACATCCAACTCGAGTTGGATGTGAACATGGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025991.1-1133s1c1
Sequence:CCGGCCTGGGAAAGATGCCATATATCTCGAGATATATGGCATCTTTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025991
KBTBD4 MISSION shRNA Lentiviral Transduction Particles
kelch repeat and BTB (POZ) domain containing 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025991.3-1192s21c1
Sequence:CCGGGCAGTTATCTACTATCGGGTACTCGAGTACCCGATAGTAGATAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025991.3-363s21c1
Sequence:CCGGCCGATCCATGTTCACATCCAACTCGAGTTGGATGTGAACATGGATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025991.3-1132s21c1
Sequence:CCGGCCTGGGAAAGATGCCATATATCTCGAGATATATGGCATCTTTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025991.3-1677s21c1
Sequence:CCGGGCTGCTTACCAACTTGCAGTTCTCGAGAACTGCAAGTTGGTAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025991.1-1678s1c1
Sequence:CCGGGCTGCTTACCAACTTGCAGTTCTCGAGAACTGCAAGTTGGTAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025991.1-2146s1c1
Sequence:CCGGCCAGCAAGAATCAACTGTAAACTCGAGTTTACAGTTGATTCTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025991.1-1193s1c1
Sequence:CCGGGCAGTTATCTACTATCGGGTACTCGAGTACCCGATAGTAGATAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025991.1-364s1c1
Sequence:CCGGCCGATCCATGTTCACATCCAACTCGAGTTGGATGTGAACATGGATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025991.1-1133s1c1
Sequence:CCGGCCTGGGAAAGATGCCATATATCTCGAGATATATGGCATCTTTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)