EMAIL THIS PAGE TO A FRIEND

KBTBD6

kelch repeat and BTB (POZ) domain containing 6

147 Gene Product Result for
UniProtKB ID: Q86V97, Q5T6Y8, Q8N8L0, Q8NDM5, Q96MP6
Gene ID:
Rat(306073) kelch repeat and BTB (POZ) domain containing 6
cow(538461) kelch repeat and BTB (POZ) domain containing 6
dog(476934) kelch repeat and BTB (POZ) domain containing 6
Horse(100061256) kelch repeat and BTB (POZ) domain containing 6
sheep(101122871) kelch repeat and BTB (POZ) domain containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152903 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152903 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152903 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152903 Rosetta Predictions human pricing
NM_001012045 Rosetta Predictions rat pricing
XM_573824 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103357 predicted 1910
2 SASI_Hs01_00103358 predicted 2032
3 SASI_Hs01_00103359 predicted 2185
4 SASI_Hs01_00103360 predicted 863
5 SASI_Hs01_00103361 predicted 1844
6 SASI_Hs01_00103362 predicted 2086
7 SASI_Hs02_00366871 predicted 1732
8 SASI_Hs01_00103363 predicted 2262
9 SASI_Hs01_00103364 predicted 1813
10 SASI_Hs01_00103365 predicted 2205
11 SASI_Hs01_00103366 predicted 1893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012045 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038609 predicted 511
2 SASI_Rn01_00038610 predicted 927
3 SASI_Rn01_00038612 predicted 1129
4 SASI_Rn01_00038613 predicted 449
5 SASI_Rn01_00038614 predicted 611
6 SASI_Rn02_00200146 predicted 905
7 SASI_Rn01_00038616 predicted 1054
8 SASI_Rn01_00038617 predicted 646
9 SASI_Rn01_00038618 predicted 246
10 SASI_Rn02_00200147 predicted 687
11 SASI_Rn01_00038611 predicted 595
12 SASI_Rn01_00038615 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573824 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00181064 predicted 518
2 SASI_Rn01_00181065 predicted 928
3 SASI_Rn01_00181066 predicted 596
4 SASI_Rn01_00181067 predicted 1135
5 SASI_Rn01_00181068 predicted 455
6 SASI_Rn01_00181069 predicted 625
7 SASI_Rn01_00181070 predicted 988
8 SASI_Rn01_00181071 predicted 1057
9 SASI_Rn01_00181072 predicted 654
10 SASI_Rn01_00181073 predicted 254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152903
VALIDATED
KBTBD6 MISSION shRNA Bacterial Glycerol Stock
kelch repeat and BTB (POZ) domain containing 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152903.3-1824s1c1
Sequence:CCGGGCAATGACTTTCAGGAAGCCTCTCGAGAGGCTTCCTGAAAGTCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152903.3-350s1c1
Sequence:CCGGCGGCCCAAGAAGATTCACAAACTCGAGTTTGTGAATCTTCTTGGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152903.3-733s1c1
Sequence:CCGGCGACATGCTACAGCTGGAATACTCGAGTATTCCAGCTGTAGCATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152903.3-404s1c1
Sequence:CCGGGAATTAAAGGACACGGCCCATCTCGAGATGGGCCGTGTCCTTTAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152903.3-1616s1c1
Sequence:CCGGCGAGACCCTATTACTGGAGTTCTCGAGAACTCCAGTAATAGGGTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152903.3-1846s1c1
Sequence:CCGGCGTCTTCAATGAGGAGATCTACTCGAGTAGATCTCCTCATTGAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152903.3-1767s1c1
Sequence:CCGGGCATGTTCTGTTATGATCCTACTCGAGTAGGATCATAACAGAACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152903.3-2256s1c1
Sequence:CCGGCAGGAAGTTCAAGTTCTCTTTCTCGAGAAAGAGAACTTGAACTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152903.3-2176s1c1
Sequence:CCGGCCTCACTGAAGAAGAAGAAATCTCGAGATTTCTTCTTCTTCAGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152903.3-1103s1c1
Sequence:CCGGGAAGAAGATCAGGACTACTTACTCGAGTAAGTAGTCCTGATCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152903
VALIDATED
KBTBD6 MISSION shRNA shRNA Plasmid DNA
kelch repeat and BTB (POZ) domain containing 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152903.3-1824s1c1
Sequence:CCGGGCAATGACTTTCAGGAAGCCTCTCGAGAGGCTTCCTGAAAGTCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152903.3-350s1c1
Sequence:CCGGCGGCCCAAGAAGATTCACAAACTCGAGTTTGTGAATCTTCTTGGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152903.3-733s1c1
Sequence:CCGGCGACATGCTACAGCTGGAATACTCGAGTATTCCAGCTGTAGCATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152903.3-404s1c1
Sequence:CCGGGAATTAAAGGACACGGCCCATCTCGAGATGGGCCGTGTCCTTTAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152903.3-1616s1c1
Sequence:CCGGCGAGACCCTATTACTGGAGTTCTCGAGAACTCCAGTAATAGGGTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152903.3-1846s1c1
Sequence:CCGGCGTCTTCAATGAGGAGATCTACTCGAGTAGATCTCCTCATTGAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152903.3-1767s1c1
Sequence:CCGGGCATGTTCTGTTATGATCCTACTCGAGTAGGATCATAACAGAACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152903.3-2256s1c1
Sequence:CCGGCAGGAAGTTCAAGTTCTCTTTCTCGAGAAAGAGAACTTGAACTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152903.3-2176s1c1
Sequence:CCGGCCTCACTGAAGAAGAAGAAATCTCGAGATTTCTTCTTCTTCAGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152903.3-1103s1c1
Sequence:CCGGGAAGAAGATCAGGACTACTTACTCGAGTAAGTAGTCCTGATCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152903
VALIDATED
KBTBD6 MISSION shRNA Lentiviral Transduction Particles
kelch repeat and BTB (POZ) domain containing 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152903.3-1824s1c1
Sequence:CCGGGCAATGACTTTCAGGAAGCCTCTCGAGAGGCTTCCTGAAAGTCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152903.3-350s1c1
Sequence:CCGGCGGCCCAAGAAGATTCACAAACTCGAGTTTGTGAATCTTCTTGGGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152903.3-733s1c1
Sequence:CCGGCGACATGCTACAGCTGGAATACTCGAGTATTCCAGCTGTAGCATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152903.3-404s1c1
Sequence:CCGGGAATTAAAGGACACGGCCCATCTCGAGATGGGCCGTGTCCTTTAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152903.3-1616s1c1
Sequence:CCGGCGAGACCCTATTACTGGAGTTCTCGAGAACTCCAGTAATAGGGTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152903.3-1846s1c1
Sequence:CCGGCGTCTTCAATGAGGAGATCTACTCGAGTAGATCTCCTCATTGAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152903.3-1767s1c1
Sequence:CCGGGCATGTTCTGTTATGATCCTACTCGAGTAGGATCATAACAGAACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152903.3-2256s1c1
Sequence:CCGGCAGGAAGTTCAAGTTCTCTTTCTCGAGAAAGAGAACTTGAACTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152903.3-2176s1c1
Sequence:CCGGCCTCACTGAAGAAGAAGAAATCTCGAGATTTCTTCTTCTTCAGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152903.3-1103s1c1
Sequence:CCGGGAAGAAGATCAGGACTACTTACTCGAGTAAGTAGTCCTGATCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)