EMAIL THIS PAGE TO A FRIEND

KBTBD7

kelch repeat and BTB (POZ) domain containing 7

54 Gene Product Result for
UniProtKB ID: Q8WVZ9, B5TZ86, Q5T6Y7, Q8NB99, Q9H0I6
Gene ID:
Mouse(211255) kelch repeat and BTB (POZ) domain containing 7
domestic guinea pig(100730225) kelch repeat and BTB (POZ) domain containing 7
naked mole-rat(101701460) kelch repeat and BTB (POZ) domain containing 7
sheep(101107365) kelch repeat and BTB (POZ) domain containing 7
Zebrafish(794299) kelch repeat and BTB (POZ) domain containing 7
cow(539110) kelch repeat and BTB (POZ) domain containing 7
Horse(100061221) kelch repeat and BTB (POZ) domain containing 7
dog(485467) kelch repeat and BTB (POZ) domain containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032138 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032138 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032138 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024135 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024135 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024135 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU165701 MISSION® esiRNA esiRNA targeting mouse Kbtbd7 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032138 Rosetta Predictions human pricing
NM_001024135 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034139 predicted 2077
2 SASI_Hs01_00034141 predicted 997
3 SASI_Hs01_00034142 predicted 2124
4 SASI_Hs01_00034143 predicted 2309
5 SASI_Hs02_00359364 predicted 1721
6 SASI_Hs01_00034144 predicted 2384
7 SASI_Hs01_00034145 predicted 1738
8 SASI_Hs01_00034146 predicted 1715
9 SASI_Hs01_00034147 predicted 896
10 SASI_Hs01_00034148 predicted 2119
11 SASI_Hs01_00034140 predicted 1827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024135 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163897 predicted 2023
2 SASI_Mm01_00163898 predicted 2162
3 SASI_Mm01_00163900 predicted 2065
4 SASI_Mm01_00163901 predicted 1777
5 SASI_Mm01_00163902 predicted 2302
6 SASI_Mm01_00163903 predicted 2056
7 SASI_Mm01_00163904 predicted 1446
8 SASI_Mm01_00163905 predicted 1760
9 SASI_Mm02_00287559 predicted 2314
10 SASI_Mm01_00163906 predicted 2142
11 SASI_Mm01_00163899 predicted 1735
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032138
KBTBD7 MISSION shRNA Bacterial Glycerol Stock
kelch repeat and BTB (POZ) domain containing 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032138.3-1844s1c1
Sequence:CCGGGTAGTGACTTTCAGGAAGCATCTCGAGATGCTTCCTGAAAGTCACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032138.3-2068s1c1
Sequence:CCGGGAGTATGATACTAGGGAAGATCTCGAGATCTTCCCTAGTATCATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032138.3-1978s1c1
Sequence:CCGGCACAACTACCAGATTGTCAATCTCGAGATTGACAATCTGGTAGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130223    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032138.3-2543s1c1
Sequence:CCGGCATCCTGAAAGTCCAGAATTACTCGAGTAATTCTGGACTTTCAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032138.3-2512s1c1
Sequence:CCGGGTCCATGAAATCGACCTGTTTCTCGAGAAACAGGTCGATTTCATGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032138.3-1987s1c1
Sequence:CCGGCAGATTGTCAATCATGACCAACTCGAGTTGGTCATGATTGACAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032138.4-1936s21c1
Sequence:CCGGGAATGGAGGCGGATTAGTAATCTCGAGATTACTAATCCGCCTCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032138.4-1749s21c1
Sequence:CCGGAGTGGTTCAGAACTATCTTTACTCGAGTAAAGATAGTTCTGAACCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032138.4-2467s21c1
Sequence:CCGGTGGTTTAGAAAGGGTAATATTCTCGAGAATATTACCCTTTCTAAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032138
KBTBD7 MISSION shRNA shRNA Plasmid DNA
kelch repeat and BTB (POZ) domain containing 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032138.3-1844s1c1
Sequence:CCGGGTAGTGACTTTCAGGAAGCATCTCGAGATGCTTCCTGAAAGTCACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032138.3-2068s1c1
Sequence:CCGGGAGTATGATACTAGGGAAGATCTCGAGATCTTCCCTAGTATCATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032138.3-1978s1c1
Sequence:CCGGCACAACTACCAGATTGTCAATCTCGAGATTGACAATCTGGTAGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130223    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032138.3-2543s1c1
Sequence:CCGGCATCCTGAAAGTCCAGAATTACTCGAGTAATTCTGGACTTTCAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032138.3-2512s1c1
Sequence:CCGGGTCCATGAAATCGACCTGTTTCTCGAGAAACAGGTCGATTTCATGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032138.3-1987s1c1
Sequence:CCGGCAGATTGTCAATCATGACCAACTCGAGTTGGTCATGATTGACAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032138.4-1936s21c1
Sequence:CCGGGAATGGAGGCGGATTAGTAATCTCGAGATTACTAATCCGCCTCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032138.4-1749s21c1
Sequence:CCGGAGTGGTTCAGAACTATCTTTACTCGAGTAAAGATAGTTCTGAACCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032138.4-2467s21c1
Sequence:CCGGTGGTTTAGAAAGGGTAATATTCTCGAGAATATTACCCTTTCTAAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032138
KBTBD7 MISSION shRNA Lentiviral Transduction Particles
kelch repeat and BTB (POZ) domain containing 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032138.3-1844s1c1
Sequence:CCGGGTAGTGACTTTCAGGAAGCATCTCGAGATGCTTCCTGAAAGTCACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032138.3-2068s1c1
Sequence:CCGGGAGTATGATACTAGGGAAGATCTCGAGATCTTCCCTAGTATCATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032138.3-1978s1c1
Sequence:CCGGCACAACTACCAGATTGTCAATCTCGAGATTGACAATCTGGTAGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130223    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032138.3-2543s1c1
Sequence:CCGGCATCCTGAAAGTCCAGAATTACTCGAGTAATTCTGGACTTTCAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032138.3-2512s1c1
Sequence:CCGGGTCCATGAAATCGACCTGTTTCTCGAGAAACAGGTCGATTTCATGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032138.3-1987s1c1
Sequence:CCGGCAGATTGTCAATCATGACCAACTCGAGTTGGTCATGATTGACAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032138.4-1936s21c1
Sequence:CCGGGAATGGAGGCGGATTAGTAATCTCGAGATTACTAATCCGCCTCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032138.4-1749s21c1
Sequence:CCGGAGTGGTTCAGAACTATCTTTACTCGAGTAAAGATAGTTCTGAACCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032138.4-2467s21c1
Sequence:CCGGTGGTTTAGAAAGGGTAATATTCTCGAGAATATTACCCTTTCTAAACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024135
KBTBD7 MISSION shRNA Bacterial Glycerol Stock
kelch repeat and BTB (POZ) domain containing 7
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024135.1-1305s1c1
Sequence:CCGGCCGAGATCCATTTCTCTGTTACTCGAGTAACAGAGAAATGGATCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024135.1-1993s1c1
Sequence:CCGGCGAGTCACAGTATATGAGTATCTCGAGATACTCATATACTGTGACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024135.1-4283s1c1
Sequence:CCGGCGATTATTCATCTGCACAATTCTCGAGAATTGTGCAGATGAATAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024135.1-4282s1c1
Sequence:CCGGCCGATTATTCATCTGCACAATCTCGAGATTGTGCAGATGAATAATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024135.1-3866s1c1
Sequence:CCGGCCATGCAAATTCCTCTTTATTCTCGAGAATAAAGAGGAATTTGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024135.1-2128s1c1
Sequence:CCGGCAGAGTTTCATCACTGAGGAACTCGAGTTCCTCAGTGATGAAACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024135.1-1455s1c1
Sequence:CCGGGAAAGACCTATGGGTGTATAACTCGAGTTATACACCCATAGGTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024135
KBTBD7 MISSION shRNA shRNA Plasmid DNA
kelch repeat and BTB (POZ) domain containing 7
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024135.1-1305s1c1
Sequence:CCGGCCGAGATCCATTTCTCTGTTACTCGAGTAACAGAGAAATGGATCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024135.1-1993s1c1
Sequence:CCGGCGAGTCACAGTATATGAGTATCTCGAGATACTCATATACTGTGACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024135.1-4283s1c1
Sequence:CCGGCGATTATTCATCTGCACAATTCTCGAGAATTGTGCAGATGAATAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024135.1-4282s1c1
Sequence:CCGGCCGATTATTCATCTGCACAATCTCGAGATTGTGCAGATGAATAATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024135.1-3866s1c1
Sequence:CCGGCCATGCAAATTCCTCTTTATTCTCGAGAATAAAGAGGAATTTGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024135.1-2128s1c1
Sequence:CCGGCAGAGTTTCATCACTGAGGAACTCGAGTTCCTCAGTGATGAAACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024135.1-1455s1c1
Sequence:CCGGGAAAGACCTATGGGTGTATAACTCGAGTTATACACCCATAGGTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024135
KBTBD7 MISSION shRNA Lentiviral Transduction Particles
kelch repeat and BTB (POZ) domain containing 7
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024135.1-1305s1c1
Sequence:CCGGCCGAGATCCATTTCTCTGTTACTCGAGTAACAGAGAAATGGATCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024135.1-1993s1c1
Sequence:CCGGCGAGTCACAGTATATGAGTATCTCGAGATACTCATATACTGTGACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024135.1-4283s1c1
Sequence:CCGGCGATTATTCATCTGCACAATTCTCGAGAATTGTGCAGATGAATAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024135.1-4282s1c1
Sequence:CCGGCCGATTATTCATCTGCACAATCTCGAGATTGTGCAGATGAATAATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024135.1-3866s1c1
Sequence:CCGGCCATGCAAATTCCTCTTTATTCTCGAGAATAAAGAGGAATTTGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024135.1-2128s1c1
Sequence:CCGGCAGAGTTTCATCACTGAGGAACTCGAGTTCCTCAGTGATGAAACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024135.1-1455s1c1
Sequence:CCGGGAAAGACCTATGGGTGTATAACTCGAGTTATACACCCATAGGTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)